SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > SOLiD



Similar Threads
Thread Thread Starter Forum Replies Last Post
how to get uniquely aligned reads from bowtie anurupa Bioinformatics 7 10-11-2019 08:05 AM
How BWA and Bowtie mention unique reads in SAM files? Nico86 Bioinformatics 0 04-24-2013 01:17 PM
Bowtie --sam option - includes non-aligned reads? ledsall Bioinformatics 3 02-24-2013 12:31 AM
Obtain file from Bowtie containing only aligned reads in SAM format shanebrubaker Bioinformatics 2 08-04-2012 10:28 AM
From sam file, how to the mate aligned or not? fabrice Bioinformatics 2 08-09-2011 10:37 AM

Reply
 
Thread Tools
Old 10-19-2013, 02:26 AM   #1
stqa8350
Member
 
Location: cambridge, ma

Join Date: Apr 2011
Posts: 13
Default SAM files aligned by Bowtie - Mystified.

Hi,

This is one of my first forays in SOLID data so please bear with me if the question is basic;

I had aligned SOLID data individually (forward, reverse) using bowtie color space -
bowtie -t -p 4 -C --sam --chunkmbs 1000 /Bowtie-Reference/Bowtie-C/h_sapiens_37_asm_c -f read1.csfasta -Q read1.QV.qual read1.sam

I ended up getting a sam file with what appears to me a malformed sam files;

1_2_1079_F3 4 * 0 0 * * 0 0 CCGTGATGGCTACCCCTGGGGTTACATATAAATT *?626A@@:@-@@@@2>>@6*5=**.;.--<@=3 XM:i:0

1_3_10_F3 0 gi|224589818|ref|NC_000006.11| 33410152 255 33M * 0 0 ATTCCCGCCTCTCCTTTCATTTGTCCACATCTC \IFIAGPMOYZL>PRAN`a/#S30FHP?J/!!' XA:i:2 MD:Z:33 NM:i:0 CM:i:4

I kind of figured that "*" on 3rd column, "@" and some CIGAR sequence in the next line as mal-formed elements. I would very much appreciate if anyone can shed some light on this and suggest any solution to this problem.

Thanks

Uma
stqa8350 is offline   Reply With Quote
Old 10-21-2013, 09:59 AM   #2
westerman
Rick Westerman
 
Location: Purdue University, Indiana, USA

Join Date: Jun 2008
Posts: 1,104
Default

I am not sure I understand your question. It appears to me that your first SAM line (starting with '1_2...') is a valid line where the read does not map while your second SAM lines (starting with '1_3...') is also a valid line that represents a read that does map.
westerman is offline   Reply With Quote
Old 10-21-2013, 11:50 AM   #3
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480
Default

Quote:
Originally Posted by westerman View Post
I am not sure I understand your question. It appears to me that your first SAM line (starting with '1_2...') is a valid line where the read does not map while your second SAM lines (starting with '1_3...') is also a valid line that represents a read that does map.
One thing I noticed is that the phred scores for the second read span too big of a range to be any of the typical formats.

Edit: Although perhaps it's just not one I've ever seen! I had a reply similar to your written yesterday before noticing the Phred issue.
dpryan is offline   Reply With Quote
Reply

Tags
sam file, solid

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:26 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO