SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
GATK undefined variable problem doc.ramses Bioinformatics 9 07-30-2012 04:29 AM
Problem GATK with CountCovariates amathieu Bioinformatics 7 02-27-2012 01:28 AM
gatk indel calling problem Alex Renwick Bioinformatics 6 12-02-2011 12:25 PM
problem about GATK indel VQSR wanguan2000 Bioinformatics 2 11-07-2011 07:15 AM
GATK - Problem amathieu Bioinformatics 2 09-26-2011 05:23 AM

Reply
 
Thread Tools
Old 01-09-2012, 01:30 PM   #1
mschizas
Junior Member
 
Location: New York

Join Date: Jan 2012
Posts: 1
Default Problem with GATK ReadBackedPhasing

Hello,

I want to use ReadBackedPhasing module of GATK on my data, but I have a problem which I think is beacuse in my bam file I have both records from BWA aligner and Novoalign. Just as a reminder, this is the command to run ReadBackedPhasing:

java
-jar GenomeAnalysisTK.jar
-T ReadBackedPhasing
-R reference.fasta
-I reads.bam <--- Input seq BAM file
--variant SNPs.vcf <--- SNP VCF file
-L Chr.list
-o phased_SNPs.vcf
--phaseQualityThresh 20.0

So when I try to run ReadBackedPhasing the output contains very few results because it crashed. I assume that happens when it hits a novoalign record in the bam file. An example of two records(one from BWA and the other from Novoalign) in the same bam file is shown below:

1)HWI-ST395_B80MA2ABXX_1:6:6:3197:146608#0 99 chrM 4874 60 104M = 5329 559 AACTAGCCCCCATCTCAATCATATACCAAATCTCTCCCTCACTAAACGTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGT
TGAGGTGGA
..fastq seq...
X0:i:1 X1:i:0 MD:Z:104 RG:Z:2_2-600-1st XG:i:0 AM:i:37 NM:i:0 SM:i:37 XM:i:0 XO:i:0 XT:A:U

2)HWI-ST395_B81AMYABXX_0:1:65:18036:20406#0 99 chrM 4874 150 2S93M9S = 2384 -2430 NNAACTAGCCCCCATCTCAATCATATACCAAATCTCTCCCTCACTAAACGTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCA
GTTGAGGTG
..fastq seq..
MD:Z:93 PG:Z:novoalign.23 RG:Z:2_2-MP-novoalign AM:i:150 NM:i:0 SM:i:150 ZO:Z:-+ PQ:i:245 UQ:i:66 AS:i:66

The difference is that even though both are in SAM format, Novoalign uses different flags which might cause this problem. If you could please help me, I would greatly appreciate it. Also would you suggest a way to convert Novoalign's SAM file into a regular SAM file with the proper flags?

Thanks a lot,
Mike
mschizas is offline   Reply With Quote
Old 05-26-2012, 06:41 AM   #2
ymc
Senior Member
 
Location: Hong Kong

Join Date: Mar 2010
Posts: 498
Default

My experience with ReadBackedPhasing is to run it without --variant SNPs.vcf

I find that when I ran with it, it took forever and then crashed at the end.

Without --variant SNPs.vcf, it can run to completion and it seems to me the result is ok.
ymc is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:40 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO