SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Standalone BLAST output MattN Bioinformatics 8 02-01-2015 11:17 PM
Standalone Blast output jomaco Bioinformatics 1 01-31-2012 07:18 AM
Standalone blast jomaco Bioinformatics 3 11-26-2011 07:02 AM
Help with standalone blast Ami General 0 09-07-2010 01:37 AM
Help with Standalone Blast Ash Bioinformatics 2 08-23-2010 05:14 AM

Reply
 
Thread Tools
Old 04-27-2012, 08:51 AM   #1
dacotahm
Member
 
Location: ND, USA

Join Date: Oct 2011
Posts: 27
Default Standalone BLAST output format question

I'm using stand-alone BLAST to align transcripts I've assembled of a non-model species to the drosophila transcriptome. I want my output to be a CSV file that includes the actual NAME of the gene. Those names are listed in the standard blast output, but I can't figure out what switch to use to get it into the CSV.

The best I can do right now is get a sequence id- something like FBtr072340098, which I can search default blast output for and find the names manually...

My command line looks something like:

blastn -query sep-final.fasta -db dmel.fasta -out sepxdmel.csv -outfmt '10 qseqid sseqid qseq evalue length'

What I really want is a CSV that has something like:

NAME=abd-b,comp11522_c0_seq1,FBtr072340098,length=750,evalue=1e-51,ACGAATCTCTTGCTTACCGCTTCGCAAACCCCTACGAC

Which will make it easy for my labmates who don't do this kind of computer work to have an easy file they can search for a gene name to find a sequence to make primers and probes.

Any advice?
dacotahm is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:12 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO