SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to count aligned RNA-seq reads after sequenced and aligned by Illumina? IceWater Illumina/Solexa 5 04-05-2012 09:18 AM
how to filter unaligned duplicate reads HESmith Bioinformatics 4 11-30-2011 02:13 AM
unaligned reads of tophat ae_ucla RNA Sequencing 1 04-07-2011 10:06 AM
Seqman Leaves most of the reads unaligned Mansequencer Bioinformatics 5 07-28-2010 02:05 PM
Reorganize unaligned read output lew13 Bioinformatics 2 03-14-2010 06:56 PM

Reply
 
Thread Tools
Old 10-25-2012, 08:09 AM   #1
newBioinfo
Member
 
Location: US

Join Date: Mar 2012
Posts: 36
Default aligned and unaligned database

Hi Everyone,
I am very confused here, I am not able to get the difference between aligned and unaligned database.
Here is an example of an aligned database:
>AF515816.1
.............................................................................................................................................................
.............................................................................................................................................................
.............................................................................................................................................................
.............................................................................................................................................................
.............................................................................................................................................................
.............................................................................................................................................................
.....................................................................................................A------T-G--A-C-G-C--T-G-G-C--G-G--C-A-T-G----------C---
-T-T--TA-C--AC-A----T-G--C----A-A-G--T-C--GA-A-CG-----------G-CAG--C-G--G------------------------------------G-G-G-C-----------------------------------------
-------------------------------------------------------------------------------------------------------------------------------------------------------------
---------------------------------------------TTC-G-----------------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------------------------------------------------------------G-
-C--C-T-------------------------G-C-C----G--GC--G-------AG-T-G-G-C-GA-A--C-------------G-G-------------------------------------------------------------------
------------------------------------------------------------------------------------------------------------------------------------------------G--T--G-A--G-
T-A---AT-G-C-A--T-C-GG---A-A--C-GT-G--C-C-CAG--TC-A----------------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------------------------------------------------------------------------------
------T-G--G----G--G--G---AT-AA-C--TA-------------------------C-G-C------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------------------------------------------G--A-A-A-----------------------GCG-T-A
-G-CT--A-A-TA---C-C-G--C-A--T-A----------C-------------------------------------------------------------------------------------------------------------------

And the unaligned database looks like this:
>S000406428 uncultured bacterium; BND5 Lineage=Root;rootrank;Bacteria;domain;"Actinobacteria";phylum;Actinobacteria;class;Acidimicrobidae;subclass;Acidimicr
obiales;order;"Acidimicrobineae";suborder;Acidimicrobiaceae;family;Acidimicrobium;genus
tgccggggactcgtaggggactgccggagttaattcggaggaaggtggggacgacgtcaagtcatcatgccccttacgtc
cagggctgcacgcatgctacaatggccggtncaaagggtcgccaacccgcgagggggagccaatcccaaaaaaccggtct
cagttcggatcggcagtctgcaactcgactgcttgaagtcggaktcgctagtaatcccggatcancacgccggggtgaat
acgttcccgggccttgtacacaccgcccgt


Please can anyone explain me the difference.
Thanks for the help!!!!!!!!!
newBioinfo is offline   Reply With Quote
Old 10-25-2012, 08:19 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

http://www.bioperl.org/wiki/FASTA_mu...ignment_format

http://www.cgl.ucsf.edu/chimera/docs...er/afasta.html

http://square.bioinfo.cnio.es/SQUAREfasta.html

Last edited by GenoMax; 10-25-2012 at 08:25 AM.
GenoMax is offline   Reply With Quote
Old 10-29-2012, 10:46 PM   #3
me_myself_andI
Member
 
Location: Singapore

Join Date: Nov 2010
Posts: 30
Default

Hard to say without giving us more info. The unaligned version looks like it was downloaded from RDP. The other one doesn't, so I presume it was produced with some program. Then the dots could mean anything from gaps to no consensus change and masked region etc etc.
me_myself_andI is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:46 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO