SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Samtools "is recognized as '*'" "truncated file" error axiom7 Bioinformatics 3 11-26-2014 02:53 AM
Local BLAST: How to parse the "non matching" elements ? Giorgio C Bioinformatics 2 09-07-2011 07:43 AM
The position file formats ".clocs" and "_pos.txt"? Ist there any difference? elgor Illumina/Solexa 0 06-27-2011 07:55 AM
"Systems biology and administration" & "Genome generation: no engineering allowed" seb567 Bioinformatics 0 05-25-2010 12:19 PM
SEQanswers second "publication": "How to map billions of short reads onto genomes" ECO Literature Watch 0 06-29-2009 11:49 PM

Reply
 
Thread Tools
Old 04-13-2012, 09:59 PM   #1
ManuSetty
Junior Member
 
Location: New York

Join Date: Aug 2011
Posts: 1
Default bowtie2 failing with "Could not parse passthrough output:" error

Hello,

I am trying to align 100bp paired-end reads using bowtie2. Its failing with the following error:

Could not parse passthrough output:
HWI-ST972:10570RNTACXX:3:1103:11595:190910 133 chr12 24364013 0 * = 24364013 0 ACTCCATCCGTGTTTCTTTTCTAGACTGGGCTGGATGCATCCCAATTCCCCACTGTTTTCCAGAGGCAGATCCTCATTAGTGGGAGCACTGGATGGGGGG [email protected]@FFDFFDF2AAFFGHIJIIIEHJJJJJIIJJIEGH9GIE9DECHGGHIIHGGFHGHIGHIGG=CGEH?EDB?;?;A>C.([email protected]@ADDCD:>A(9?<

This is the command I use:
time nice -n 20 bowtie2 -x ~/data/sequencing/bowtie2-indexes/mm9 -1 AGTCAA_L003_R1_001.fastq -2 AGTCAA_L003_R2_001.fastq -S AGTCAA_L003.sam --un-conc AGTCAA_L003_001_R%_unmapped.fastq

The last line before failure in AGTCAA_L003.sam is
HWI-ST972:10570RNTACXX:3:1103:11595:190910 73 chr12 24364013 0 95M1I4M = 24364013 0 ATGTGGCAGTTTCCCACAAGTGTGCCTACCAGCAAGGCAATTGCAAGAACAAGGTCCTTTGACCCCACATCCAGTGCTCCCACTAATGAGGATCTGCCTC @CCDDFFFHHHHHJJJJJGJFHEHHIIJGHIGCIJJJJIIJJIJIHHIIJJJFHBFHGHIIIIEIGHHDEHHFFFCDFECDEEDCDDACDCADCDDACDD AS:i:-33 XS:i:-33 XN:i:0 XM:i:5 XO:i:1 XG:i:1 NM:i:6 MD:Z:0G1C4T86A2A1 YT:Z:UP


I am able to run the two files to completion when I run separately. But paired end alignment fails with error above. Looks like its not able to create the SAM record properly. Can you shed some light on this?

Thanks!
Manu
ManuSetty is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:56 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO