SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
snpEFF annotation - "NA" bioinfobeginner Bioinformatics 0 06-26-2016 12:16 PM
error in building annotation database by SnpEff loyaltman Bioinformatics 2 03-22-2016 04:50 PM
database snpeff vs dbsnp in variant annotation bongbimit Bioinformatics 0 04-05-2014 10:40 PM
snpEff annotation omerfaruk Bioinformatics 1 01-06-2014 12:25 AM
dbSNP updates and the effect on variant annotation results warrenemmett Bioinformatics 0 10-18-2011 12:31 PM

Reply
 
Thread Tools
Old 07-07-2021, 01:38 AM   #1
najoshi
Junior Member
 
Location: Davis, CA

Join Date: Feb 2010
Posts: 12
Default snpeff effect annotation confusion

So I am trying to figure out why this particular complex variant was annotated with an effect of "start_lost" when I don't see any evidence of the start codon being changed. Here is the full vcf line:

Code:
chr1	20717668	.	ACGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAA	GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC	566.598	.	AB=0.347826;ABP=12.2627;AC=5;AF=0.5;AN=10;AO=16;CIGAR=1X57M1X;DP=46;DPB=46.1525;DPRA=0;EPP=5.18177;EPPR=4.16842;GTI=0;LEN=59;MEANALT=1;MQM=60;MQMR=60;NS=5;NUMALT=1;ODDS=5.38955;PAIRED=0.5625;PAIREDR=0.466667;PAO=9;PQA=333;PQR=0;PRO=0;QA=586;QR=1103;RO=30;RPL=13;RPP=16.582;RPPR=31.9633;RPR=3;RUN=1;SAF=7;SAP=3.55317;SAR=9;SRF=8;SRP=17.1973;SRR=22;TYPE=complex;ANN=GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3961|1/3090|1/1029||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_001122819.3|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3958|1/3087|1/1028||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_001122819.3|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|5_prime_UTR_variant|MODIFIER|KIF17|KIF17|transcript|NM_001287212.2|protein_coding|1/15|c.-447_-389delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2098|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|NM_001103161.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541459.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541460.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541462.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|XM_011541461.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|downstream_gene_variant|MODIFIER|SH2D5|SH2D5|transcript|NM_001103160.2|protein_coding||c.*4066_*4124delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|||||2063|,GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|intron_variant|MODIFIER|LOC107985528|LOC107985528|transcript|unknown_transcript_1|protein_coding|987/1510|c.167449+904178_167449+904236delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC||||||WARNING_TRANSCRIPT_MULTIPLE_STOP_CODONS;LOF=(KIF17|KIF17|3|0.67)	GT:DP:AD:RO:QR:AO:QA:GL	0/1:4:3,1:3:111:1:37:-2.49371,0,-9.14896	0/1:9:6,3:6:221:3:109:-13.5154,0,-16.9355	0/1:11:6,5:6:223:5:182:-16.4518,0,-16.8162	0/1:12:8,4:8:294:4:149:-22.2684,0,-21.995	0/1:10:7,3:7:254:3:109:-13.2144,0,-19.5986
The first annotation looks like this:

Code:
GCGGCAGCGCACGACAACCTTCACCGCCTCGGAGGCCATGGCGCCGCGCCCAGGACCAC|start_lost|HIGH|KIF17|KIF17|transcript|NM_020816.4|protein_coding|1/15|c.-20_39delTTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGTinsGTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC|p.MetAlaSerGluAlaValLysValValValArgCysArg1?|340/3961|1/3090|1/1029||
For some reason it is calling it a deletion & insertion instead of just two separate SNPs. Looking at the two sequences:

Code:
TTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGT
GTGGTCCTGGGCGCGGCGCCATGGCCTCCGAGGCGGTGAAGGTTGTCGTGCGCTGCCGC
you can see that all of the bases are the same except for the first and last bases. The start codon is in the middle, i.e. this variant crosses the 5'UTR to exon 1 boundary. However, the start codon does not change, so why is it being annotated as a "start_lost"?
najoshi is offline   Reply With Quote
Reply

Tags
hgvs, snpeff, variant calling

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:18 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO