SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Indexing- Exons and splice sites New2Bioinfo General 5 12-15-2016 08:01 AM
Predicting Cryptic Splice Sites? Rocketknight Bioinformatics 0 06-20-2013 07:41 AM
splice sites-annotation rudi283 Bioinformatics 0 09-23-2011 04:36 AM
reference sequence - splice sites marada General 2 02-11-2010 05:08 AM

Reply
 
Thread Tools
Old 04-28-2017, 12:53 PM   #1
mattdoug
Junior Member
 
Location: Vancouver, BC

Join Date: Apr 2017
Posts: 1
Default HISAT2 not reporting all splice sites?

I'm using HISAT2 (version 2.0.5) to try and find novel splice sites. Going through the SAM file it produces suggests that there are a number of alignments supporting the existence of splice junctions that are not being reported (i.e. the aren't in the file you get from using the "--novel-splicesite-outfile" option).

For example, the SAM record for one of the reads is:

SRR360120.14138165 83 V 12814114 60 9M1297N91M = 12813953 -261 ATCCCATGTCTTAATTAAACTTGTGGTAACTTTTAATGAATTAAACTTCTGATT[email protected][email protected][email protected]<[email protected]@@ AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:100 YS:i:251 YT:Z:CP XS:A:- NH:i:1

The way it's split suggests that there is a splice junction at V:12814123-12815419, but there's no such entry in the file of reported splice sites.

For comparison, I ran TopHat (version 2.1.0) and it produced the same alignment for this read. The difference is that TopHat DOES report the expected splice junction at V:12,814,123-12,815,419.

So, is there some criteria I'm missing that causes HISAT2 to not report certain splice junctions, even if there are alignments supporting them?
mattdoug is offline   Reply With Quote
Reply

Tags
hisat2, rna-seq, splicing

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:05 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO