SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Making sense of tophat output "align_summary.txt" yangjr Bioinformatics 3 11-03-2016 08:20 AM
how to compare tophat output files with and without "_random" sequences EA01 Illumina/Solexa 2 06-21-2013 12:05 AM
TopHat "-M" option and Unmapped.bam file washy RNA Sequencing 2 05-24-2013 06:20 AM
Some "wrong" XS:A in Tophat output for strand specific pair-end RNA-Seq data ct586 Bioinformatics 4 05-08-2013 05:15 PM
How do you deal with reads "unmapped to NM_0012345"? kgulukota Bioinformatics 8 02-15-2012 11:29 PM

Reply
 
Thread Tools
Old 08-11-2014, 07:05 AM   #1
capricy
Senior Member
 
Location: 63130

Join Date: Apr 2012
Posts: 125
Default Tophat output contains "unmapped"??

Hello, there,

I recently examined the output of tophat (tophat22.0.8) after converting them into sam file, and found that the following results:

grep "HWI-ST514:143982632:C37PRACXX:5:1101:12852:4786" accepted_hits.ns.sam
HWI-ST514:143982632:C37PRACXX:5:1101:12852:4786 89 A_ref-1.0_Cont33 766585 50 92M * 0 0 CTTGTATTGAGTACGATCTCTCCACCTCTCCGGTTCGCAATACAGCTTTGAGAAAGAACTTATTACCCTCTCTACTATATAATTAAATTGTA DDDDEDDDDDDDDDDDBDCDDDAACDDFHHJJJJJJJJIIHHJJJJJJJJJJJJJJJIJJIHFC:JJHGIIJJIJJJJJJJJJJJJJHHHFF MD:Z:92 XG:i:0 NH:i:1 NM:i:0 XM:i:0 XN:i:0 XO:i:0 AS:i:0 YT:Z:UU
HWI-ST514:143982632:C37PRACXX:5:1101:12852:4786 137 A_ref-1.0_Cont33 766582 50 100M * 0 0 TTCCTTGTATTGAGTACGATCTCTCCACCTCTCCGGTTCGCAATACAGCTTTGAGAAAGAACTTATTACCCTCTCTACTATATAATTAAATTGTACTTTG CCCFFFFFHHHHHJGIIJJJJJJJJJJJJIJIIJJJFGIIJJJJJJJJIJHIJJJJJJJJHHHHHFFFFFFFDEEEEDEDEDEFEEEECCEDCCDEEFED MD:Z:100 XG:i:0 NH:i:1 NM:i:0 XM:i:0 XN:i:0 XO:i:0 AS:i:0 YT:Z:UU

The reference is the genome scaffolds here. My question is about the samflag: 89 represents read paired,mate unmapped,read reverse strand,first in pair; 137 represents read paired, mate unmapped, second in pair.

These reads appear to be paired, and both mapped. Then why did samflag say their mates were not mapped? Is it because they did not map to the same scaffold?

Could anyone explain this to me?

Thanks
capricy is offline   Reply With Quote
Old 08-11-2014, 07:30 AM   #2
westerman
Rick Westerman
 
Location: Purdue University, Indiana, USA

Join Date: Jun 2008
Posts: 1,104
Default

It is Tophat, not samtools, that sets the flags. So look at Tophat for answers to your question. I presume you mean version 2.0.8 and not 22.0.8; if so a newer version of Tophat may give better results.

I haven't used Tophat in about a year so treate the following with caution. For your specific question you say ".. Is it because they did not map to the same scaffold?..." but to my eye it looks like they did map to the same scaffold.

1st read to A_ref-1.0_Cont33 at base 766585
2nd read to A_ref-1.0_Cont33 at base 766582

Same scaffold with a 3-bp overlap. My guess is that this is why Tophat did not consider the two to have the mate mapped.
westerman is offline   Reply With Quote
Old 08-11-2014, 11:08 AM   #3
capricy
Senior Member
 
Location: 63130

Join Date: Apr 2012
Posts: 125
Default

I meant that they did not map to the same strand of the scaffold...
capricy is offline   Reply With Quote
Old 08-11-2014, 11:42 AM   #4
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480
Default

This appears to be a bug that was fixed in version 2.0.9, which was released over a year ago.
dpryan is offline   Reply With Quote
Old 08-11-2014, 01:28 PM   #5
capricy
Senior Member
 
Location: 63130

Join Date: Apr 2012
Posts: 125
Default

@dpryan, could you please explain a bit more? What is the correct information supposed to look like?
capricy is offline   Reply With Quote
Old 08-11-2014, 01:31 PM   #6
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480
Default

What do you mean "what is the correct information supposed to look like"? You're using an old version with a known bug (the one you're asking about). Just upgrade.
dpryan is offline   Reply With Quote
Old 08-11-2014, 02:24 PM   #7
capricy
Senior Member
 
Location: 63130

Join Date: Apr 2012
Posts: 125
Default

well, upgrade and rerun, might take several days.

So I wonder if the changes for these two reads in new tophat2.0.9 will be in samflag fields?

Thanks
capricy is offline   Reply With Quote
Old 08-11-2014, 11:51 PM   #8
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480
Default

Yeah, it should just fix the flags. In this example, the flags should become 83 and 163.

BTW, if you switch to STAR you'll get alignments vastly faster.
dpryan is offline   Reply With Quote
Old 08-12-2014, 07:30 AM   #9
capricy
Senior Member
 
Location: 63130

Join Date: Apr 2012
Posts: 125
Default

thank you very much for explanations!
capricy is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:50 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO