SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Paired-end strand specific RNA-seq dekontrol RNA Sequencing 2 10-06-2012 11:22 PM
TopHat: Aligning SOLiD strand specific RNAseq Ender985 RNA Sequencing 3 07-09-2012 10:37 PM
.wig files for strand-specific paired-end RNA-Seq ulitskyi RNA Sequencing 4 06-12-2012 11:27 PM
strand specific RNAseq Pepe Sample Prep / Library Generation 5 10-27-2011 07:58 AM
What is this strand specific pair-end RNA-seq data? xhuister Bioinformatics 2 09-14-2010 06:34 AM

Reply
 
Thread Tools
Old 12-06-2012, 05:10 AM   #1
mknut
Member
 
Location: UK

Join Date: Jul 2012
Posts: 23
Default RNASeq paired-end strand specific attribute location in FASTA file

According to TopHat documentation ( for --library-type option) if a strand-specific protocol was used in paired-end sequencing there should be an XS attribute tag assigned to every read. Right - I got my reads in FASTA format - where is my XS tag? If it's not there, where would it normally be? First four reads from raw FASTA file:

Code:
@A:3:1101:1441:2249#CTTGCAAC/1 CGCTGGGGCACAGTGACAGGAAACTGAGCAAAACAGCTCGTTGGCACTGATATGCCCCTCCCACCTCCCAGCTCCTGACTCCTATGGGCTGTTGGCTGCC 
+A:3:1101:1441:2249#CTTGCAAC/1 bbbeeeeegggggfghiiiihhhhghdghhhiiihiiidgghghiihhifggfhcegfhiggggeeeebdddbbcbbbcc]bR]b]acbccbYbc^ 
@A:3:1101:1593:2030#CTTGCAAC/1 NTGGAAGCAGCAGGTGGAATCCAAGAATATGCCCTTTCAGGATGGCCAAGAATTTGAACTGAGCATCTCAGTGCTGCCAGATAAGTACCAGGTAATGGTC 
+A:3:1101:1593:2030#CTTGCAAC/1 BP\c`acae^eegdffdeabgfdgddgff^egfghPI^cafhhhhZacfgfhghfghggbe_dghbfdgdgdgabZ^`bbbbbbabbbcbbb_

Last edited by mknut; 12-06-2012 at 05:11 AM. Reason: code tags
mknut is offline   Reply With Quote
Old 12-06-2012, 08:12 AM   #2
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

I'm assume the edit has messed up the line breaks (it looked OK via my RSS feed).

Next, you have a FASTQ file there, not a FASTA file.

Finally, I believe you are asking about using an XS tag which applies to a SAM/BAM file (not in FASTA or FASTQ files).
maubp is offline   Reply With Quote
Old 12-06-2012, 08:44 AM   #3
mknut
Member
 
Location: UK

Join Date: Jul 2012
Posts: 23
Default

My bad, mixed up the files. Found it now. Thanks
mknut is offline   Reply With Quote
Reply

Tags
fasta, paired-end, rnaseq, strand specific

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:40 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO