SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Quality-, adapter- and RRBS-trimming with Trim Galore! fkrueger Bioinformatics 136 01-18-2019 01:24 AM
trim galore error JQL Bioinformatics 23 02-17-2015 11:21 AM
FastQC output: Do I trim these? wilson90 Bioinformatics 1 08-16-2013 12:01 AM
Do I need to run trim galore even if my reads are of good quality? genomics_search Bioinformatics 1 03-06-2013 11:30 AM
How to integrate Trim Galore in Galaxy? sachitad RNA Sequencing 2 10-19-2012 02:54 AM

Reply
 
Thread Tools
Old 10-09-2013, 04:55 AM   #1
shocker8786
Member
 
Location: Urbana Illinois

Join Date: Jan 2013
Posts: 28
Default Trim Galore output issue

I have both RRBS and RNAseq datasets that I'm trying to filter for quality and trim adaptors using Trim Galore. When I run it on the RRBS fq files using the --RRBS option, the resulting fq output looks fine:

@HWI-ST330:336274FACXX:3:1101:13152:1997 1:N:0:CTTGTA
NGGGTTGTTTTATGGAGAGCGGAGGGT
+
#4=DDDFDHHHHHJJIJIIGJJIIJJ?
@HWI-ST330:336274FACXX:3:1101:14593:1999 1:N:0:CTTGTA
NGGTAATTCGTTTTTTATAAGGCGAAT
+
#1=DFFFFHHHHHJJJJJJJHGIJJJJ
@HWI-ST330:336274FACXX:3:1101:18911:1998 1:N:0:CTTGTA
NGGGGTTTAGACGTAGTAGGTGTTTT
+
#1=DFDDFHHHHHGHJGHIJAFFHIJ

But when I run it on the RNAseq samples without the --RRBS option, there are additional spaces in the fastq output:

@DBRHHJN1:326:C233EACXX:1:1101:1305:1193 1:N:0:ATCACG
CTTTNTGTGGCTCAGGATGGAGGTGGCCACATTGGCCAGCAACTCAGCCAGGCCGGGGCCTTCCTTCCCAGCAATTCGAGGCGCGGCCAGCGCCTGCCGC

+
???D#2=ADDDDDIIIIEFIEEF+CEDE>DDEIIEDBED=DDCEBDD@CDDDCDDIAD>@?AAAAAAA?AA=??AAA?E?>5;>;>95;8<;;>>???>>

@DBRHHJN1:326:C233EACXX:1:1101:1287:1222 1:N:0:ATCACG
CTTGNAAATGGCGTCAAAGGTGGCCTTGGCGAAGTTGCCCAGGGTGGCAGTGCAGCCCCTGGCAGAGGTGTAGCAGTCATCAATTCCTGCCATCATCAGC

+
?@@D#2=AFHH?FH<ECFHHHGGEEGEGH@D@)?DHI9?BCFGIHII=@?7A;7?>BB?ACCA=?(98,<C:C:5,53:@>>4:@::@@CB>@93>>:::

@DBRHHJN1:326:C233EACXX:1:1101:1252:1244 1:N:0:ATCACG

I've tried running it a few different ways, and discovered that I only get the output with added spaces when I don't use the --RRBS option. My question is how do I fix this issue? I don't want to use the --RRBS option with the RNAseq data, as it will remove an additional 2bp from the trimmed reads. Is there a way to prevent Trim Galore from adding these spaces? Or is there a way for me to remove the spaces from the output files? Thanks!
shocker8786 is offline   Reply With Quote
Old 10-09-2013, 05:43 AM   #2
choishingwan
Member
 
Location: Hong Kong

Join Date: Feb 2012
Posts: 21
Default

The simplest way might be to use awk? (but will be slow)

Quote:
awk '{if(length($0)>=1)print $0}' input.fq
something like that, I haven't tested the code though...
choishingwan is offline   Reply With Quote
Old 10-09-2013, 07:06 AM   #3
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 625
Default

This was a bug that had been introduced accidentally... If you get the latest version of Trim Galore it should be fine, sorry for the inconvenience caused. This is from the latest release notes:

Code:
10-09-13: Version 0.3.3 released

    Fixed a bug what was accidentally introduced which would add an additional empty line in single-end trimming mode
fkrueger is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:28 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO