SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Best/favorite global pairwise alignment program for proteins Khen General 0 05-06-2013 11:04 AM
Merging Pairwise Sequence Alignment loba17 Bioinformatics 10 12-17-2012 04:59 AM
fastest pairwise alignment method Trilliput Bioinformatics 0 10-19-2012 11:59 AM
R mismatch position in pairwise alignment NicoBxl Bioinformatics 4 10-27-2010 08:36 AM
BLAST Alignment Length iam.candice Bioinformatics 1 08-04-2009 06:43 PM

Reply
 
Thread Tools
Old 12-04-2013, 03:38 PM   #1
Genomics101
Member
 
Location: Maryland, USA

Join Date: May 2012
Posts: 60
Default Reformatting BLAST+ pairwise alignment?

Greetings!

The default for BLAST+ output is a pairwise alignment broken up into 60bp increments:

Code:
Query  1     TTATTTTTCTTGATAGAATTAATTCTAATATTAGCACATTAAAAAATACTAAGTC-AAAT  59
             ||||||| ||||||||  |||||| |||||||| |||||||||||||| |||||| ||||
Sbjct  542   TTATTTTGCTTGATAGCGTTAATTATAATATTACCACATTAAAAAATATTAAGTCAAAAT  601

Query  60    TGTAATATTTCATTTGATATTGTATGCATACAATTTT-ATC---T--TACCTTTAAGAAT  113
             ||||||||||||||||||  ||||||||||||||||| |||   |  ||||||||| |||
Sbjct  602   TGTAATATTTCATTTGAT-CTGTATGCATACAATTTTAATCTTATCATACCTTTAATAAT  660

Query  114   ATGTATAA-TAATTTATACCCATGTAGTT-TATTAAAT--A-AACAT-ATTTGTGCGTAT  167
             |||||||| |||| |||| | | ||| |   || ||||  |    || |||| | |||||
Sbjct  661   ATGTATAATTAATATATATCAACGTATTCGAATCAAATGGATTTAATGATTTTTTCGTAT  720

Query  168   CCAATGCGTTTATCTATTGTTATTACTA-T--TA-T--TATTGTTACTGCTATATCACTG  221
               ||| |||||||||||||||||||||| |  || |  |||| ||| ||| || ||||||
Sbjct  721   TTAATACGTTTATCTATTGTTATTACTATTACTATTACTATTATTATTGCCATCTCACTG  780
I inquired with NCBI about a command for BLAST+ (ne้ StandALone BLAST) to have the aligment break at different increments or not at all. Like this:

Code:
Query  1     TTATTTTTCTTGATAGAATTAATTCTAATATTAGCACATTAAAAAATACTAAGTC-AAATTGTAATATTTCATTTGATATTGTATGCATACAATTTT-ATC---T--TACCTTTAAGAAT 113
             ||||||| ||||||||  |||||| |||||||| |||||||||||||| |||||| ||||||||||||||||||||||  ||||||||||||||||| |||   |  ||||||||| |||
Sbjct  542   TTATTTTGCTTGATAGCGTTAATTATAATATTACCACATTAAAAAATATTAAGTCAAAATTGTAATATTTCATTTGAT-CTGTATGCATACAATTTTAATCTTATCATACCTTTAATAAT  660
They forwarded the request on to the development team, but don't have that functionality at the time in BLAST+. I was hoping someone might have had the same thought and wrote a little script to reformat these alignments?

Thanks!

Last edited by Genomics101; 12-04-2013 at 03:42 PM.
Genomics101 is offline   Reply With Quote
Old 12-04-2013, 05:53 PM   #2
gringer
David Eccles (gringer)
 
Location: Wellington, New Zealand

Join Date: May 2011
Posts: 838
Default

Use a different output format (ASN, CSV, or XML). The default text-based format is only meant to be for viewing, not data manipulation, and can change without notice.
gringer is offline   Reply With Quote
Old 12-05-2013, 02:53 AM   #3
lindenb
Senior Member
 
Location: France

Join Date: Apr 2010
Posts: 143
Default

Save your blast result as XML and process it with a XSLT stylesheet.

Examples:

* http://www.biostars.org/p/6635/

* http://www.biostars.org/p/85258/
lindenb is offline   Reply With Quote
Reply

Tags
blast+

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:02 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO