SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Sequencing Ion PGM libraries using Ion Proton MissDNA Ion Torrent 2 03-03-2014 11:07 AM
Ion Proton Q20 JPC Ion Torrent 8 11-05-2013 06:39 AM
Library prep kits for Ion PGM or Ion Proton Bioo Scientific Vendor Forum 0 02-18-2013 06:25 AM
Ion Torrent libraries on proton? Apex Ion Torrent 2 12-12-2012 06:33 AM
Ion Torrent $1000 Genome!? Benchtop Ion Proton Sequencer aeonsim Ion Torrent 88 10-28-2012 04:50 AM

Reply
 
Thread Tools
Old 10-29-2014, 04:21 PM   #1
ElizabethRoss
Junior Member
 
Location: Melbourne, Australia

Join Date: Oct 2014
Posts: 5
Default chimeric RNAseq reads on Ion Proton??

Hi All,
I am noticing evidence of chimeric reads coming from the ion proton, ie, the reads are half my organism of interest (lets say human) and half something else (Half ERCC control).

When BLAST'ed to nt, half the read hits human, and half it hits an ERCC control fragment. This is not a one off, I see it in data generated in-house and also some public human RNAseq data that I downloaded.

Has anyone else seen this? Are you aware of any documentation on these chimers? Do you agree with my interpretation of the result?

The example read is from SRA:
>SRR902918.363 AF94H:00015:07753 length=142
CGCATAGTCGCCATTCACAGATTTGCTCGGCAATCAGTACTGAAAGGCTAAGGCAGGTGAATCACCTGAGCTCAGGAGTTCAAGACCA

Thanks for your help.
Attached Images
File Type: png Proton chimera.png (9.6 KB, 7 views)
ElizabethRoss is offline   Reply With Quote
Old 10-29-2014, 05:10 PM   #2
danwiththeplan
Member
 
Location: Auckland

Join Date: Sep 2011
Posts: 72
Default

That particular study from the SRA used five platforms (Illumina’s HiSeqs, Life Technologies’ Personal Genome Machine and Proton, Roche 454 GS FLX, and Pacific Biosciences RS) so I'd be curious as to whether the other platforms are showing chimeras as well.
danwiththeplan is offline   Reply With Quote
Old 10-29-2014, 06:03 PM   #3
ElizabethRoss
Junior Member
 
Location: Melbourne, Australia

Join Date: Oct 2014
Posts: 5
Default

I had a look at one of the Illumina libraries from that study also; I could not detect chimeras in the Illumina data. I think the issue may be something to do with the proton library construction, most likely during a PCR step.
My main concern is the presence of chimera in the library that are two piece of independent human RNA that are joined, as they will be less trivial to remove/filter/trim.
I will have a look at the other platform data, but it may take me a few days to find the time.
ElizabethRoss is offline   Reply With Quote
Old 10-29-2014, 08:53 PM   #4
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

I've seen chimeric reads on various platforms, including Illumina. I think it is important to always design analyses to be robust against potential chimeras, as they could be anywhere. But hopefully, they will tend to be random joins, such that a given chimera only occurs once (aside from PCR duplicates).

When doing things like scaffolding, it is never safe to join two contigs on the bases of a single read pair (and I'm not implying 2 pairs make it safe, either), exactly because of problems like chimeric reads. And RNA-seq data seems to be even more prone than DNA to have strange reads that are possibly artifacts, such as chimeras.
Brian Bushnell is offline   Reply With Quote
Reply

Tags
chimera, ercc, ion proton, rnaseq

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:43 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO