SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
TopHat Error: Could not find Bowtie index files /bowtie-0.12.5/indexes/. rebrendi Bioinformatics 11 06-22-2016 09:55 AM
Sequence and quality are inconsistent myronpeto Bioinformatics 9 10-29-2013 02:06 PM
samtools view error after reheader Hkins552 Bioinformatics 3 07-17-2011 10:32 AM
Samtools view error message Jan Bioinformatics 4 06-07-2010 02:45 PM
tophat - cannot view sam output in samtools tview lmilne Bioinformatics 2 12-01-2009 12:13 PM

Reply
 
Thread Tools
Old 06-29-2010, 01:09 AM   #1
glacierbird
Member
 
Location: germany

Join Date: Dec 2009
Posts: 15
Question samtools view error: CIGAR and sequence length are inconsistent (tophat/bowtie)

Hi,
When I try to use "samtools view" to creat .bam file from .sam, I get these error msg. The .sam file is created by mapping raw illumina reads with tophat.

samtools view -bS -t index.fa.fai -o accepted_hits.bam accepted_hits.sam
The tag [ID] required for [PG] not present.
[sam_header_read2] 7409 sequences loaded.
Parse error at line 8263: CIGAR and sequence length are inconsistent

This #line 8263 is like this:

head -n 8263 accepted_hits.sam |tail -n 1
HWI-EAS210R:5:55:1018:1930#0 0 SL1.00sc00002 428427 0 36M92N36M473N536870911M * 0 0 CTCATCTCTCATCTCAGAGAGGTCCTCCAGGAGCAGGAATATAAGTTGGATCAAGTACGCAATCATCTTCA XXQZXR^Ta\[a\ZVZ^ZYXWWYPSUMSSQXZTO^ZZPV_\`_U\VYY[W^G\SJSTTRTUTXFTTQTYVS NM:i:0 XS:A:+ NS:i:0

Anybody could explain me why Samtools gave such error msg?
Thanks!
glacierbird is offline   Reply With Quote
Old 06-29-2010, 01:29 AM   #2
glacierbird
Member
 
Location: germany

Join Date: Dec 2009
Posts: 15
Default

I think the problem is caused by:

36M92N36M473N536870911M

But, I don't know how could it occur?
glacierbird is offline   Reply With Quote
Old 06-29-2010, 01:58 AM   #3
glacierbird
Member
 
Location: germany

Join Date: Dec 2009
Posts: 15
Default

I think the solution could be:
reformat the raw .fastq file.

Maybe, somewhere is not Tab, but space.

then, 536870911M
will not occur.
glacierbird is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:41 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO