SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
sam to bam conversion error, no @SQ lines in the header, missing header? efoss Bioinformatics 17 12-03-2015 04:28 AM
[PICARD] Problems with SAM/BAM files without header apeltzer Bioinformatics 2 02-10-2014 04:44 AM
Picard MergeSamFiles resulting in read duplication and loss of pair information canisirius Bioinformatics 0 10-01-2012 08:46 AM
merging bam files with different headers dnusol Bioinformatics 2 02-06-2012 11:09 PM
Error "RG ID on SAMRecord not found in header" from Picard's MarkDuplicates.jar‏ cliff Bioinformatics 4 11-10-2011 03:27 AM

Reply
 
Thread Tools
Old 07-05-2015, 10:57 PM   #1
Tally
Member
 
Location: Sydney

Join Date: Aug 2011
Posts: 12
Default Picard MergeSamFiles: 'RG ID on SAMRecord not found in header' yet BAM has headers

Hi all,

I have a whole genome mammalian sample that was sequenced on 2 lanes of Illumina Hiseq.

I have aligned the paired fastq with BWA mem and sorted with SAMtools.

I merged the 2 BAM files with SAMtools but attempting to run GATK RealignerTargetCreator threw the following error:
" SAM/BAM file SAMFileReader{/project/RDS-FVS-Cribbing-RW/FM2001_Out/FM2001_rmdup.bam} is malformed: Read HWI-ST1206:760WV0ACXX:1:2212:18877:61235 uses a read group (D0WV0ACXX) that is not defined in the BAM header, which is not valid."

I then realised that SAMtools takes only the RG header from the first BAM in the list, so I tried to instead use Picard's MergeSamFiles. This gives me the following error, but I do have unique RG headers for the 2 BAMs I am attempting to merge:
"Exception in thread "main" htsjdk.samtools.SAMFormatException: SAM validation error: ERROR: Record 1, Read name HWI-ST1206:7910WJACXX:5:1307:3604:24593, RG ID on SAMRecord not found in header: D10WJACXX"

Here are the RG and PG headers of the two BAMs:

@RG ID10WJACXX PL:illumina PU10WJACXX LB:FM_FM2001_1 SM:FM_FM2001 CN:UniversityOfBern
@PG ID:bwa PN:bwa VN:0.7.12-r1039 CL:/usr/local/bwa/0.7.12/bwa mem -t 12 -R @RG rgID10WJACXX PL:illumina PU10WJACXX LB:FM_FM2001_1 SM:FM_FM2001 CN:UniversityOfBern /project/RDS-FVS-Cribbing-RW/equcab2.fasta /project/RDS-FVS-Cribbing-RW/FM2001/p-HORSE_D10WJACXX_GGCTAC_FM2001_R1.fastq.gz /project/RDS-FVS-Cribbing-RW/FM2001/p-HORSE_D10WJACXX_GGCTAC_FM2001_R2.fastq.gz

@RG ID0WV0ACXX PL:illumina PU0WV0ACXX LB:FM_FM2001_1 SM:FM_FM2001 CN:UniversityOfBern
@PG ID:bwa PN:bwa VN:0.7.12-r1039 CL:/usr/local/bwa/0.7.12/bwa mem -t 12 -R @RG rgID0WV0ACXX PL:illumina PU0WV0ACXX LB:FM_FM2001_1 SM:FM_FM2001 CN:UniversityOfBern /project/RDS-FVS-Cribbing-RW/equcab2.fasta /project/RDS-FVS-Cribbing-RW/FM2001/p-HORSE_D0WV0ACXX_GGCTAC_FM2001_R1.fastq.gz /project/RDS-FVS-Cribbing-RW/FM2001/p-HORSE_D0WV0ACXX_GGCTAC_FM2001_R2.fastq.gz

(Note: I have performed a reheader on these BAMs following a bug and a solution described at this page http://gatkforums.broadinstitute.org...and-gatk-error)

The RG tags of the reads do match the RG headers, here is one read from each BAM:

HWI-ST1206:7910WJACXX:1:1101:1120:2193 99 18 74721856 60 101M = 74721945 190 TATCTGATGATTTTTATAAGCTATAAATTCAAGGAGGGATTGGCTAGGAGATTGTTCTGCTCCATAATGGCGTTGACTAGACGGCCATTTGATGGTATTCA CCCFFFFFHHHHHFIIIJJJJJIJJJJJIJJJJJHIFIGGHEIIIJIJJJIHHJHIIJFIJJGHGIJIEIIGBHDEBEEDCEABDDBDCDDEDCC>CCCCD NM:i:0 MD:Z:101 AS:i:101 XS:i:0 RG:Z10WJACXX

HWI-ST1206:760WV0ACXX:1:1101:1161:2233 121 19 757702 60 101M = 757702 0 GAATTCTGTAGTCTTTTTGACTGGAAGACTAGACGGCAGAGATCAAGGCATCTCCCGCCTCTAAGAATTGAGAGGATATCCCAGAAAAGAGGATATCCCAG ###################################################B:;@GB9FCGG9IIIFCGHBIIHBIIHECH@EGE<@GHFHHBDDBB1;?; NM:i:4 MD:Z:3A18T10A16G50 AS:i:82 XS:i:20 RG:Z0WV0ACXX


I have tried without editing the headers from RG to rgID, and get the error described on the link listed above.
I have tried enclosing the RG header within the PG header in single tick marks and also get an error.
I have tried filling the ID value as '1' for each of the BAMs instead of the flow cell id. Still throws an error.

The error from Picard's MergeSamFiles states"...is not defined in the BAM header, which is not valid" --> I don't see what is invalid about my RG headers?

I have used this same RG header type in many alignments using the same pipeline, just with single BAMs per sample. GATK has never had a problem with my BAMs or RG headers before.

Any suggestions most welcome.
Tally is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:45 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO