SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Annovar and variants with a MAF = 1 in fileterd file polgimenez Bioinformatics 0 04-27-2015 02:38 AM
Convert maf (multiple alignment file) to FASTA Avro1986 Bioinformatics 4 12-17-2012 11:12 AM
Creating Phylogenetic tree from MAF format file mez Bioinformatics 3 09-04-2012 09:02 AM
How to correct BAM file EOF marker absent error vinay052003 Bioinformatics 11 04-25-2012 09:00 PM
Correct input file format for SLOPE? Heisman Bioinformatics 2 09-21-2011 06:20 AM

Reply
 
Thread Tools
Old 07-29-2016, 05:54 AM   #1
balaena
Member
 
Location: Germany

Join Date: Jan 2015
Posts: 29
Default correct syntax for species delimitation in a maf file

Hi,

I want to analyse and manipulate genome alignments with maffilter. So far I have only aligned two de-novo assembled genomes with LAST but as far as I can see, this can only align two genomes (which for now is sufficient, but for next genomes I have to switch to something like Mugsy I think).
But my problem for now is, how to specify species in the maf-file? The assembled scaffolds were given as two multiple fasta files to LAST, with sequence names scaffold_1, _2 etc., and that is what maffilter is complaining about (scaffold_7 invalid sequence name). So somewhere the species have to be defined (although in a two species alignment where one is the reference this should be no problem?).

I have researched the internet and nowhere I could find any clear statement how the sequences have to be named correctly either in the source fasta or in the resulting maf.

Below is the first part of the two genome maf.

Someone has an idea?

Thanks!
Code:
# LAST version 553
#
# a=7 b=1 A=7 B=1 e=35 d=14 x=34 y=7 z=34
# R=11 u=2 s=2 T=0 m=100 l=1 n=100 k=1 i=8192 w=1000 t=0.727769 g=1 j=3 Q=0
# triaddb
# Reference sequences=174 normal letters=91719965
#
#    A  C  G  T
# A  1 -3 -3 -3
# C -3  1 -3 -3
# G -3 -3  1 -3
# T -3 -3 -3  1
#
# Coordinates are 0-based.  For - strand matches, coordinates
# in the reverse complement of the 2nd sequence are used.
#
# name start alnSize strand seqSize alignment
#
# m=1 s=35
#
a score=15539 mismap=1e-10
s scaffold_7 1976237 16386 + 5881857 AGTAGTATGACAATGTTGATAAAACTTACGGTTCGGCTTCTAACGAGCTGATCTCAGCAACATAATTGCAGGGAATATAACCACGTAAGCCGCTACGTCT
balaena is offline   Reply With Quote
Old 06-10-2020, 05:10 AM   #2
zajic
Junior Member
 
Location: Prague, Czech republic

Join Date: Jul 2014
Posts: 2
Default

Hello, I know that this is an old question, but may be it can help to someone using maffilter. I had the same problem and looking at the source code I figured out that maffilter is parsing sequence name and is expecting do there.
I resolved the problem by renaming sequence names so that they contain dots

Code:
sed -i -e 's/scaffold_m16_p_1/mMolMol1.p1/g' test2.maf
sed -i -e 's/scaffold_m19_p_1/mMyoMyo1.p1/g' test2.maf
zajic is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:54 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO