SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Custom Index Adapters Ingeneious Illumina/Solexa 4 05-21-2015 09:24 PM
miseq custom primers barturas Illumina/Solexa 1 07-01-2013 06:46 AM
custom sequencing primers athos Illumina/Solexa 5 02-04-2011 11:47 AM
SE adapters and PE primers PaulineF Illumina/Solexa 2 02-09-2010 12:10 PM
custom adenylated adapters Bioo Scientific Vendor Forum 0 10-30-2009 03:03 PM

Reply
 
Thread Tools
Old 11-10-2015, 06:56 PM   #1
Xaki
Junior Member
 
Location: BC

Join Date: Oct 2015
Posts: 4
Default By how much custom primers can overlap adapters?

By how much 5' ends of custom sequencing primers are allowed to overlap with the P5 and P7 flow cell adapters on MiSeq cell?
More specifically, with these sequences:
P5: 5' AATGATACGGCGACCACCGA 3'
P7: 5' CAAGCAGAAGACGGCATACGA 3'

Has anyone tried complete overlap?

Thanks
Xaki is offline   Reply With Quote
Old 11-11-2015, 04:15 AM   #2
bunce
Member
 
Location: Perth

Join Date: Sep 2012
Posts: 55
Default

Hi Xaki, yes we tried a complete overlap with no success. Still not 100% why this didn't work but we gave up after about 3-4 runs (and tried a lot of things). So we ended up using a custom primer. The custom primer we use overlaps 4 bp. however our p5 is:
P5 5'-AATGATACGGCGACCACCGAGATCTACAC-3'

And our first 4bp of our custom primer (p5 end) is 5'-ACAC......

in total our custom primer is 22bp and contains some LNA's to keep the size down a bit and the melt temp high.

hope this helps, regards, Mike.
bunce is offline   Reply With Quote
Old 11-11-2015, 08:35 AM   #3
Xaki
Junior Member
 
Location: BC

Join Date: Oct 2015
Posts: 4
Default

Thank you bunce. This is helpful to know that complete overlap does not work. I wonder why? Do you see clusters forming at all?
Your primer design is same as ours. We also start from ACAC...
Has anyone tried to go a bit deeper into flow cell adapters sequence?
Xaki is offline   Reply With Quote
Old 11-11-2015, 03:26 PM   #4
bunce
Member
 
Location: Perth

Join Date: Sep 2012
Posts: 55
Default

Hi Xaki. Yes - clusters formed. I am not sure why we could never get decent sequences. I suspect it might be that the 'vision' that all the libraries are lined up as nice organised vertical strands of DNA is misleading.... and that a lot of clusters exist in a bridged form. This represents an issue when trying to sneak in a custom primer. We tried altering the run recipe (annealing temp) to try and get the sequencing primer to bind before a cluster could bridge. But eventually gave up - the sequencing efficiency was too low.

The flow cell grafted P5 has a 'U' to enable cleavage of the strand - I think this is why it may not be possible to steal a few more bases? not really sure. Cheers Mike.
bunce is offline   Reply With Quote
Old 11-12-2015, 12:15 PM   #5
Xaki
Junior Member
 
Location: BC

Join Date: Oct 2015
Posts: 4
Default

There is a similar thread here. Some think you can extend custom sequencing primer into flow cell adapter with no problems, but I do not see anyone with direct experience doing that and getting good results.

Last edited by Xaki; 11-12-2015 at 12:57 PM.
Xaki is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:45 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO