Freebayes 0.9.9 problems

newbietonextgen · 06-12-2013, 10:01 AM

Hello All,

I am trying to run freebayes version 0.9.9 and am having problems. I am used pervious versions and never encountered these problems.

The command is use:

freebayes -XuiP 0.01 -f /path_to_fasta_file -b 40077_sorted_RG.bam -b 40079_sorted_RG.bam -v trial.freebayes.vcf

The output on the terminal: (never seen it doing this before)

GACAGGCCAGGCAGAACAGACGGCTGCTTCATGTCGTCTGTGTCTACAGCAGCTATTGCAAAGGCCCATCCGTACCCCCTGGGATCCTTGAAATGCCCCTTCGGACGTAATCCGTACCGAGTATGCACGGAGCCCCTGGGCCCGTCACGACGGGATGCTTCTGCCGCTCAGTTCAGCGAGGCTCATTTTGGCCTCCAGCGCAGTCAGTCCTTGAGAGCCCCCGTGCGCACCACGAACGCAAAGCCAAACATAGCAAAGACAAACAGGAACAGTACTGCGGCACCTCCCATTGCCGCTCCTCGTACCGACTGAGTCATTATTGCGAGAACTGTGGGCAGCGTTCCCAGACGGCTTTCCGACTACAAATGAGTGCTTTCGGACCCGCTGTGCCCACTGCGGCGTGCCGCTGTTTCTCAGCTTTCCGCCACGACCCCTCCGTGAGGTCCTCGCTAAGAAGAGCGCTC
1:2179
Aborted

The Vcf file shows the first SNP at 1:2179 and then it stops. The bam files (read group, index, started) were used with GATK and worked fine. The output is the same even of i use one bam file to call SNPs

So what am i doing wrong?
Thanks
newbie..

newbietonextgen · 06-14-2013, 06:19 AM

a little bit of digging around and i see that an error is also posted...

Error: Exception: Cannot read past the end of the alignment's sequence.

So what does this mean? Any ideas?

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Fasta consensus, SNP call and FreeBayes	hugorody	Bioinformatics	0	05-28-2013 03:02 PM
UnifiedGenotyper vs. Varscan vs. FreeBayes for Bacterial spp. Variant Calling	Magas8282	Bioinformatics	1	05-22-2013 02:09 PM
freebayes SNP QUAL	chrishah	Bioinformatics	7	05-07-2013 05:48 AM
Error when uisng Freebayes VCF output with GATK SelectVariants	thondeboer	Bioinformatics	0	02-21-2013 05:23 PM
VCF output from FreeBayes	cigsit	Bioinformatics	4	12-20-2012 01:44 AM

06-12-2013, 10:01 AM	#1
newbietonextgen Member Location: USA Join Date: Nov 2010 Posts: 56	Freebayes 0.9.9 problems Hello All, I am trying to run freebayes version 0.9.9 and am having problems. I am used pervious versions and never encountered these problems. The command is use: freebayes -XuiP 0.01 -f /path_to_fasta_file -b 40077_sorted_RG.bam -b 40079_sorted_RG.bam -v trial.freebayes.vcf The output on the terminal: (never seen it doing this before) GACAGGCCAGGCAGAACAGACGGCTGCTTCATGTCGTCTGTGTCTACAGCAGCTATTGCAAAGGCCCATCCGTACCCCCTGGGATCCTTGAAATGCCCCTTCGGACGTAATCCGTACCGAGTATGCACGGAGCCCCTGGGCCCGTCACGACGGGATGCTTCTGCCGCTCAGTTCAGCGAGGCTCATTTTGGCCTCCAGCGCAGTCAGTCCTTGAGAGCCCCCGTGCGCACCACGAACGCAAAGCCAAACATAGCAAAGACAAACAGGAACAGTACTGCGGCACCTCCCATTGCCGCTCCTCGTACCGACTGAGTCATTATTGCGAGAACTGTGGGCAGCGTTCCCAGACGGCTTTCCGACTACAAATGAGTGCTTTCGGACCCGCTGTGCCCACTGCGGCGTGCCGCTGTTTCTCAGCTTTCCGCCACGACCCCTCCGTGAGGTCCTCGCTAAGAAGAGCGCTC 1:2179 Aborted The Vcf file shows the first SNP at 1:2179 and then it stops. The bam files (read group, index, started) were used with GATK and worked fine. The output is the same even of i use one bam file to call SNPs So what am i doing wrong? Thanks newbie..

06-14-2013, 06:19 AM	#2
newbietonextgen Member Location: USA Join Date: Nov 2010 Posts: 56	a little bit of digging around and i see that an error is also posted... Error: Exception: Cannot read past the end of the alignment's sequence. So what does this mean? Any ideas?