SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Fasta consensus, SNP call and FreeBayes hugorody Bioinformatics 0 05-28-2013 03:02 PM
UnifiedGenotyper vs. Varscan vs. FreeBayes for Bacterial spp. Variant Calling Magas8282 Bioinformatics 1 05-22-2013 02:09 PM
freebayes SNP QUAL chrishah Bioinformatics 7 05-07-2013 05:48 AM
Error when uisng Freebayes VCF output with GATK SelectVariants thondeboer Bioinformatics 0 02-21-2013 05:23 PM
VCF output from FreeBayes cigsit Bioinformatics 4 12-20-2012 01:44 AM

Reply
 
Thread Tools
Old 06-12-2013, 10:01 AM   #1
newbietonextgen
Member
 
Location: USA

Join Date: Nov 2010
Posts: 56
Default Freebayes 0.9.9 problems

Hello All,

I am trying to run freebayes version 0.9.9 and am having problems. I am used pervious versions and never encountered these problems.

The command is use:

freebayes -XuiP 0.01 -f /path_to_fasta_file -b 40077_sorted_RG.bam -b 40079_sorted_RG.bam -v trial.freebayes.vcf

The output on the terminal: (never seen it doing this before)

GACAGGCCAGGCAGAACAGACGGCTGCTTCATGTCGTCTGTGTCTACAGCAGCTATTGCAAAGGCCCATCCGTACCCCCTGGGATCCTTGAAATGCCCCTTCGGACGTAATCCGTACCGAGTATGCACGGAGCCCCTGGGCCCGTCACGACGGGATGCTTCTGCCGCTCAGTTCAGCGAGGCTCATTTTGGCCTCCAGCGCAGTCAGTCCTTGAGAGCCCCCGTGCGCACCACGAACGCAAAGCCAAACATAGCAAAGACAAACAGGAACAGTACTGCGGCACCTCCCATTGCCGCTCCTCGTACCGACTGAGTCATTATTGCGAGAACTGTGGGCAGCGTTCCCAGACGGCTTTCCGACTACAAATGAGTGCTTTCGGACCCGCTGTGCCCACTGCGGCGTGCCGCTGTTTCTCAGCTTTCCGCCACGACCCCTCCGTGAGGTCCTCGCTAAGAAGAGCGCTC
1:2179
Aborted

The Vcf file shows the first SNP at 1:2179 and then it stops. The bam files (read group, index, started) were used with GATK and worked fine. The output is the same even of i use one bam file to call SNPs

So what am i doing wrong?
Thanks
newbie..
newbietonextgen is offline   Reply With Quote
Old 06-14-2013, 06:19 AM   #2
newbietonextgen
Member
 
Location: USA

Join Date: Nov 2010
Posts: 56
Default

a little bit of digging around and i see that an error is also posted...

Error: Exception: Cannot read past the end of the alignment's sequence.


So what does this mean? Any ideas?
newbietonextgen is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:28 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO