![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
input BAM files for GATK | Jane M | Bioinformatics | 26 | 07-30-2015 10:58 PM |
GATK -T UnifiedGenotyper on multipel BAM files | nguyendofx | Bioinformatics | 3 | 04-25-2012 02:27 AM |
multiple BAM GATK unifiedgenotyper output | memento | Bioinformatics | 0 | 02-22-2012 09:12 AM |
casava 1.8 bam conversion to gatk bam | kingsalex | Bioinformatics | 1 | 02-14-2012 12:47 PM |
GATK calling Merged Bam files | jayce_ocean | Bioinformatics | 3 | 03-16-2011 01:15 AM |
![]() |
|
Thread Tools |
![]() |
#1 |
Member
Location: USA Join Date: Nov 2010
Posts: 56
|
![]()
Hi
I am having trouble with GATK ability to read my BAM files. THe BAM were created using tophat 2.0.0.4 and I used AddandReplaceReadGroups from Picard tools to do it. The code used was java -Xmx1g -jar ~/programs/picard-tools-1.47/AddOrReplaceReadGroups.jar I=/home/sudeep/work/6-20-12/layers/all_infected_bams/1_4I_accepted_hits.bam O=/home/sudeep/work/6-20-12/layers/all_infected_bams/1_4I_accepted_hits_RG.bam SORT_ORDER=coordinate RGLB=Infected RGPL=illumina RGPU=HSWI72892 RGSM=1_4I. I did use the VALIDATION_STRINGENCY=LENIENT, but to effect. I do index the BAM files. I even tried SortSAM to see if i had a problem. I looked at another thread posted here but nothing happened... http://seqanswers.com/forums/showthread.php?t=16905 The GATK run code is below.... java -Xmx4g -jar GenomeAnalysisTK.jar -R chicken_order.fa --default_platform illumina --knownSites:variant,vcf ./trial_middle.vcf -I /home/sudeep/work/6-20-12/layers/all_infected_bams/1_4I_accepted_hits_RG_reorder.bam -T CountCovariates -cov ReadGroupcovariate -cov QualityScoreCovariate -cov CycleCovariate -cov DinucCovariate -recalFile /home/sudeep/work/6-20-12/layer/all_infected_bams/1_4I_recaldata.csv INFO 02:04:00,711 HelpFormatter - --------------------------------------------------------------------------------- INFO 02:04:00,714 HelpFormatter - The Genome Analysis Toolkit (GATK) v1.6-11-g3b2fab9, Compiled 2012/06/20 13:28:25 INFO 02:04:00,714 HelpFormatter - Copyright (c) 2010 The Broad Institute INFO 02:04:00,714 HelpFormatter - Please view our documentation at http://www.broadinstitute.org/gsa/wiki INFO 02:04:00,715 HelpFormatter - For support, please view our support site at http://getsatisfaction.com/gsa INFO 02:04:00,715 HelpFormatter - Program Args: -R chicken_order.fa --default_platform illumina --knownSites:variant,vcf ./trial_middle.vcf -I /home/sudeep/work/6-20-12/layers/all_infected_bams/1_4I_accepted_hits_RG_reorder.bam -T CountCovariates -cov ReadGroupcovariate -cov QualityScoreCovariate -cov CycleCovariate -cov DinucCovariate -recalFile /home/sudeep/work/6-20-12/layer/all_infected_bams/1_4I_recaldata.csv INFO 02:04:00,716 HelpFormatter - Date/Time: 2012/06/29 02:04:00 INFO 02:04:00,716 HelpFormatter - --------------------------------------------------------------------------------- INFO 02:04:00,716 HelpFormatter - --------------------------------------------------------------------------------- INFO 02:04:00,737 GenomeAnalysisEngine - Strictness is SILENT INFO 02:04:00,822 SAMDataSource$SAMReaders - Initializing SAMRecords in serial INFO 02:04:00,851 SAMDataSource$SAMReaders - Done initializing BAM readers: total time 0.03 INFO 02:04:00,867 RMDTrackBuilder - Loading Tribble index from disk for file ./trial_middle.vcf INFO 02:04:01,774 CountCovariatesWalker - The covariates being used here: INFO 02:04:01,774 CountCovariatesWalker - ReadGroupCovariate INFO 02:04:01,774 CountCovariatesWalker - QualityScoreCovariate INFO 02:04:01,775 CountCovariatesWalker - CycleCovariate INFO 02:04:01,775 CountCovariatesWalker - DinucCovariate INFO 02:04:01,854 TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] INFO 02:04:01,855 TraversalEngine - Location processed.sites runtime per.1M.sites completed total.runtime remaining INFO 02:04:03,192 GATKRunReport - Uploaded run statistics report to AWS S3 ##### ERROR ------------------------------------------------------------------------------------------ ##### ERROR A USER ERROR has occurred (version 1.6-11-g3b2fab9): ##### ERROR The invalid arguments or inputs must be corrected before the GATK can proceed ##### ERROR Please do not post this error to the GATK forum ##### ERROR ##### ERROR See the documentation (rerun with -h) for this tool to view allowable command-line arguments. ##### ERROR Visit our wiki for extensive documentation http://www.broadinstitute.org/gsa/wiki ##### ERROR Visit our forum to view answers to commonly asked questions http://getsatisfaction.com/gsa ##### ERROR ##### ERROR MESSAGE: SAM/BAM file SAMFileReader{/home/sudeep/work/6-20-12/layers/all_infected_bams/1_4I_accepted_hits_RG_reorder.bam} is malformed: BAM file has a read with mismatching number of bases and base qualities. Offender: HWI-ST913:105:C0EYJACXX:5:1304:11235:16705 [100 bases] [0 quals] ##### ERROR ------------------------------------- Please help. I could be something very simple |
![]() |
![]() |
![]() |
#2 |
Member
Location: USA Join Date: Nov 2010
Posts: 56
|
![]()
I did find something.
This problem is only with Tophat based BAM files. I have a SHRIMP based BAM alignment and GATK works like a charm. Can any one shed some information as to why? |
![]() |
![]() |
![]() |
#3 |
Member
Location: San Francisco, CA Join Date: Jun 2010
Posts: 35
|
![]()
Maybe a tophat bug? I think this is the important line of that error:
12/layers/all_infected_bams/1_4I_accepted_hits_RG_reorder.bam} is malformed: BAM file has a read with mismatching number of bases and base qualities. Offender: HWI-ST913:105:C0EYJACXX:5:1304:11235:16705 [100 bases] [0 quals] It is saying that read has no quality values attached. Here is something you could do: run samtools view and grab that specific sequence, then see if indeed the sam line has no quality score information attached, or if it looks weird in some other way. If that is the case then maybe there is some bug with whatever version of tophat you are using? Here is one way to get that sequence: samtools view file.bam | grep "HWI-ST913:105:C0EYJACXX:5:1304:11235:16705" > bad_read.sam then you can look at bad_read.sam and see what's up. |
![]() |
![]() |
![]() |
#4 |
Member
Location: San Francisco, CA Join Date: Jun 2010
Posts: 35
|
![]()
Also what tophat command did you use to do the mapping? Could always be a good-ol phred+33 vs phred+64 issue.
|
![]() |
![]() |
![]() |
#5 |
Member
Location: San Francisco, CA Join Date: Jun 2010
Posts: 35
|
![]()
Also you might want to see if you can find that read in your fastq file and double check that it has quality values there. Sometimes fastq files can become screwed up by various processing steps. Some programs that do mapping and other downstream stuff treat a bad fastq record differently so it could be that one program is dropping that read since it has no quality scores, and the other is including it? I don't know, I am just guessing at possibilities now.
|
![]() |
![]() |
![]() |
#6 |
Member
Location: USA Join Date: Nov 2010
Posts: 56
|
![]()
Tophat: 2.0.0.4
the run command i used.. ./tophat -p 4 -G /home/sudeep/work/6-20-12/Gallus_gallus.WASHUC2.67.gtf -o /home/sudeep/work/6-20-12/layers/Infected/1_4I /home/sudeep/programs/bowtie2-2.0.0-beta6/index/chicken_order /home/sudeep/work/6-20-12/layers/Infected/1_4I_R1.fastq.gz /home/sudeep/work/6-20-12/layers/Infected/1_4I_R2.fastq.gz |
![]() |
![]() |
![]() |
#7 |
Member
Location: USA Join Date: Nov 2010
Posts: 56
|
![]()
samtools view file.bam | grep "HWI-ST913:105:C0EYJACXX:5:1304:11235:16705" > bad_read.sam
Output. looks like there is * instead of quality score. Now have to check fastq file.... HWI-ST913:105:C0EYJACXX:5:1304:11235:16705 153 1 134 3 100M * 0 0 GCCTTCAGATCCTTCTCTCCGGACCGTATGCTGACGGACTTCCCTGGCCCTGCTACCTGAGACCTGCTGCTTCCTCCCTGACTTACTCTGCGGCTTCTTC * AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:100 YT:Z:UU NH:i:2 CC:Z:= CP:i:34437630 HI:i:0 HWI-ST913:105:C0EYJACXX:5:1304:11235:16705 393 1 34437630 3 100M * 0 0 GAAGAAGCCGCAGAGTAAGTCAGGGAGGAAGCAGCAGGTCTCAGGTAGCAGGGCCAGGGAAGTCCGTCAGCATACGGTCCGGAGAGAAGGATCTGAAGGC * AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:100 YT:Z:UU NH:i:2 HI:i:1 |
![]() |
![]() |
![]() |
#8 |
Member
Location: USA Join Date: Nov 2010
Posts: 56
|
![]()
It's sanger quality (1.9 Illumina pipeline)
|
![]() |
![]() |
![]() |
#9 |
Member
Location: USA Join Date: Nov 2010
Posts: 56
|
![]()
also i have tried other software like Splice map and even the SAM file when converted to BAM doesn't pass through GATK BAM norm. SO strange. Shrimp alignment works fine...why is there so much difference in SAM format?
|
![]() |
![]() |
![]() |
#10 | |
Member
Location: germany Join Date: Jun 2012
Posts: 32
|
![]() Quote:
Hi newbietonextgen I am also facing the similar problem.Have you sorted it out? Regards |
|
![]() |
![]() |
![]() |
Thread Tools | |
|
|