|
|
|
|
|||||||
Similar Threads
|
||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| PCR primer -- a PCR simulation on your computer | gringer | General | 0 | 01-26-2012 03:03 AM |
| 454Jr run metrics - possible PCR primer contamination | NGS4YetiB | 454 Pyrosequencing | 0 | 08-18-2011 02:54 PM |
| Alternative index primer | Andrew_Slatter | Illumina/Solexa | 8 | 02-16-2011 11:39 AM |
| Query :: Unable to create index file in soapaligner | sujata | Bioinformatics | 0 | 02-06-2011 09:25 PM |
| PCR Primer Design Software for Gap-closure | bulletin2007 | 454 Pyrosequencing | 5 | 05-19-2010 12:58 PM |
 |
|
|
Thread Tools |
02-23-2010, 09:46 PM
|
#1 |
|
Junior Member
Location: China Join Date: Feb 2009
Posts: 8
|
Query about modification of PCR primer index?
I am synthesizing the PCR primer for Solexa sequencing. As is known, the primer should be modified to increase the efficiency of annealling to flow cell.
Does anybody know how to modify the primers, like Phosphorothioate in the first 4 bases? Here's the PCR Primer Index 1 I'm synthesizing CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC Thanks. |
|
|
|
| Thread Tools | |
|
|
