SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
50 bp paired end reads vs. 100 bp single end reads efoss Bioinformatics 12 01-15-2014 08:05 PM
Using Bfast to align paired end Illumina reads gavin.oliver Bioinformatics 14 01-14-2012 06:51 AM
Bowtie and reads that failed to align: (100.00%) michy Bioinformatics 7 02-08-2011 06:42 PM
bowtie and solexa paired ends wont align michy Bioinformatics 1 09-02-2010 05:46 AM
paired-end run failed in pipeline v1.3.2 ttkuaile Bioinformatics 1 04-17-2009 01:30 PM

Reply
 
Thread Tools
Old 08-23-2010, 10:55 AM   #1
rahul.m.dhodapkar
Member
 
Location: New Haven

Join Date: Jun 2010
Posts: 28
Default Bowtie Paired end 100% failed to align

Hello all,

I am trying to use Bowtie to align paired end sequencing data from solexa, but I am consistently getting

Code:
# reads processed: 3188
# reads with at least one reported alignment: 0 (0.00%)
# reads that failed to align: 3188 (100.00%)
I have tried running Bowtie's single end mapping, and have gotten both ends to align with >90% of the reads with at least one reported alignment, but the second I try paired-end, the whole thing fails, and there are no error messages to give me some sort of hint as to what is happening.

Code:
./bowtie -S -t -p 8 -q --chunkmbs 128 hg18_combined.fa.bowtie -1 Pair1.fastq -2 Pair2.fastq bowpeout.sam
is the command that I am using. Has anyone else run into this problem before? Does anyone have any ideas as to what I should do to get some of the reads to align properly?

-Rahul Dhodapkar
rahul.m.dhodapkar is offline   Reply With Quote
Old 08-23-2010, 11:40 AM   #2
john_mu
Member
 
Location: Stanford, CA

Join Date: May 2010
Posts: 88
Default

Did you check if the reads are forward-reverse? or some other orientation?
__________________
SpliceMap: De novo detection of splice junctions from RNA-seq
Download SpliceMap Comment here
john_mu is offline   Reply With Quote
Old 08-23-2010, 11:42 AM   #3
rahul.m.dhodapkar
Member
 
Location: New Haven

Join Date: Jun 2010
Posts: 28
Default Re: orientation

john,

yes I have tried running bowtie with all of the orientation options that it provides, and I consistently get the no alignment problem. But thanks for the idea

-Rahul
rahul.m.dhodapkar is offline   Reply With Quote
Old 08-23-2010, 11:55 AM   #4
Ben Langmead
Senior Member
 
Location: Baltimore, MD

Join Date: Sep 2008
Posts: 200
Default

Quote:
Originally Posted by rahul.m.dhodapkar View Post
john,

yes I have tried running bowtie with all of the orientation options that it provides, and I consistently get the no alignment problem. But thanks for the idea

-Rahul
Hi Rahul,

Are you sure the -I and -X options encompass (or mostly encompass) the distribution of insert sizes in your sequencing library?

Ben
Ben Langmead is offline   Reply With Quote
Old 08-23-2010, 12:00 PM   #5
rahul.m.dhodapkar
Member
 
Location: New Haven

Join Date: Jun 2010
Posts: 28
Default

Ben,

Yes, I am expecting to have insert sizes of about 200-300, which is pretty close to the default bowtie -I and -X options. I would certainly expect that at least one read fall into that category. Just to be sure, I ran it again with the same command as above except that the -I and -X boundaries were set to 0 1000, and I still got no reads aligned.

-Rahul
rahul.m.dhodapkar is offline   Reply With Quote
Old 08-23-2010, 12:01 PM   #6
Ben Langmead
Senior Member
 
Location: Baltimore, MD

Join Date: Sep 2008
Posts: 200
Default

Quote:
Originally Posted by rahul.m.dhodapkar View Post
Ben,

Yes, I am expecting to have insert sizes of about 200-300, which is pretty close to the default bowtie -I and -X options. I would certainly expect that at least one read fall into that category. Just to be sure, I ran it again with the same command as above except that the -I and -X boundaries were set to 0 1000, and I still got no reads aligned.

-Rahul
And when you align them as unpaired reads, the effective insert sizes you observe are in the 200-300 range?

Can you please post the full commands used to run Bowtie in unpaired and paired modes, and one example of a read that should align in paired-end mode but doesn't?

Thanks,
Ben
Ben Langmead is offline   Reply With Quote
Old 08-23-2010, 12:27 PM   #7
rahul.m.dhodapkar
Member
 
Location: New Haven

Join Date: Jun 2010
Posts: 28
Default

Code:
GA-B_0003:5:95:3459:14691#0/1	0	chr4	357461	255	99M	*	0	0	AACATAAGAAAATTCATAGTGCAGATAAACCCTACAAATGTAAAGAATGTGACAAAGCCTTTAAACAATTTTCGCTCCTGAGTCAACATAAGAAAATTC	fffffffffffffffffefffffeffffffefefffffffeffffffffefcefffedeefffecffefffff^eeffdfYfdfcfeffeef\fddfdf	XA:i:0	MD:Z:99	NM:i:0
aligned on the pair1.fq
Code:
GA-B_0003:5:95:3459:14691#0/2	0	chr4	357538	255	99M	*	0	0	CTGAGTCAACATAAGAAAATTCATACTGTAGATAAACCCTACAAATGTAAAGATTGTGACAAAGCCTTTAAACGGTTCTCACACCTGAATAAACATAAG	ecbda_cdd`f\dfffdfeadeeedddeaefffffbcdddfeffffffffcffffedfefffffdfffffffeffffffffffffffffffffffffff	XA:i:0	MD:Z:99	NM:i:0
aligned on pair2.fq

the exact commands that I used were

Code:
./bowtie -S -t -p 8 -q --chunkmbs 128 hg18_combined.fa.bowtie pair1.fastq pair1.sam
for the single end (then repeated for pair 2 with the exact same syntax.
Code:
./bowtie -S -t -p 8 -q -I 0 -X 300 --chunkmbs 128 hg18_combined.fa.bowtie -1 Pair1.fastq -2 Pair2.fastq bowpeout.sam
for the paired end mode output. hope this helps

-Rahul Dhodapkar
rahul.m.dhodapkar is offline   Reply With Quote
Old 08-23-2010, 01:01 PM   #8
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,178
Default

Rahul,

The SAM output shows that both of the reads are aligning to the forward strand (flag==0), but for Illumina paired end reads, if read 1 aligns to the forward strand then read 2 should align to the reverse. Also, the quality string for read 2 looks as if it has been reversed (poorer scores at the 5' end, improving towards the 3' end).

Did you (or someone else) reverse complement the reads in Pair2.fastq prior to running them through Bowtie? Bowtie wants the reads as they were produced by the instrument. If one of the input files has been reverse complemented the aligned pairs won't be considered correct by Bowtie.

Last edited by kmcarr; 08-23-2010 at 01:03 PM.
kmcarr is offline   Reply With Quote
Old 08-23-2010, 06:43 PM   #9
rahul.m.dhodapkar
Member
 
Location: New Haven

Join Date: Jun 2010
Posts: 28
Default

kmcarr,

working from your observation, I tried to run the bowtie paired end alignment command with the --ff option on, and it worked! Thank you all so much for your help

Gratefully,
Rahul
rahul.m.dhodapkar is offline   Reply With Quote
Old 09-12-2013, 01:15 PM   #10
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

Hi All!

I am facing some kind of the same problem, but all posted possible solutions are not working...
I tried --ff, --fr, --rf - and no result. 0% of alignment. I even tried -U option - no result.

Does anybody know what may be the reason why??
OTU is offline   Reply With Quote
Old 09-12-2013, 01:35 PM   #11
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,178
Default

Quote:
Originally Posted by OTU View Post
Hi All!

I am facing some kind of the same problem, but all posted possible solutions are not working...
I tried --ff, --fr, --rf - and no result. 0% of alignment. I even tried -U option - no result.

Does anybody know what may be the reason why??
Maybe because the reads you are trying to align aren't really from reference genome species? What did you sequence? What reference genome are you using?
kmcarr is offline   Reply With Quote
Old 09-12-2013, 01:41 PM   #12
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

The reads are from metagenome, and the reference is an indexed bowtie library of Silva SSU rRNA genes from all living organisms.
So... I t should give some hits!
OTU is offline   Reply With Quote
Old 09-12-2013, 01:44 PM   #13
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,178
Default

Quote:
Originally Posted by OTU View Post
The reads are from metagenome, and the reference is an indexed bowtie library of Silva SSU rRNA genes from all living organisms.
So... I t should give some hits!
What does "The reads are from a metagenome" mean? Is it shotgun DNA-Seq from a bacterial community or did you do create 16S amplicons and sequence those?
kmcarr is offline   Reply With Quote
Old 09-12-2013, 01:56 PM   #14
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

Sorry for confusion!

So, sequences are from sorted cells from water sample, and should be enriched in one candidate division sequences. Cells were lysed and amplified via multiple displacement amplification. After - sequenced on MySeq platform.
OTU is offline   Reply With Quote
Old 09-12-2013, 02:03 PM   #15
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,178
Default

Quote:
Originally Posted by OTU View Post
...Silva SSU rRNA genes from all living organisms.
So... I t should give some hits!
Well, Silva does not in fact have SSU genes from all living organisms.

Quote:
sequences are from sorted cells from water sample, and should be enriched in one candidate division sequences
What candidate division would that be? Could it be something not cataloged in the Silva database?
kmcarr is offline   Reply With Quote
Old 09-12-2013, 02:05 PM   #16
OTU
Member
 
Location: Utah

Join Date: May 2013
Posts: 44
Default

It candidate division TM7. It is in Silva, because probes for FISH were designed through ARB...
OTU is offline   Reply With Quote
Reply

Tags
alignment, bowtie, errors, paired-end, solexa

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:19 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO