SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
d reverse complement sequences davids Illumina/Solexa 0 06-07-2016 05:57 PM
HiSeq 2500 Rapid run dual index problems bbeitzel Illumina/Solexa 15 07-02-2015 09:57 AM
gtf file reverse complement coordinates lwhitmore Bioinformatics 4 08-20-2014 08:03 AM
Reverse complement of a bacterial gene seema12345 Introductions 4 03-07-2014 07:00 PM
Is it possible to re-sequence Index2 on a HiSeq PE dual index run? MikeNice Illumina/Solexa 3 05-29-2013 06:17 AM

Reply
 
Thread Tools
Old 04-10-2019, 03:50 PM   #1
bmreilly
Junior Member
 
Location: San Diego

Join Date: Apr 2019
Posts: 2
Default HiSeq X run: i5 index is reverse complement of i7??

Hello, I'm puzzled over an issue we are having with an Illumina HiSeq x run we completed recently for a number of reasons.

We were following the protocol for bisulfite padlock probe sequencing which we have completed successfully recently on a novaSeq 6000 without issue.

This time, unbenknownst to us, the company sequenced our libraries on a HiSeq X, which has different chemistry, and we had serious issues with the index reads.

the i7 read seems to have read correctly, but the i5 reads are all very strange, and very few reads actually demultiplexed to the i5 indexes that we used. When troubleshooting we found that many of the i5 indexes with the highest reads assigned were actually the exact reverse complement of the i7 index for those reads. Many other i5 index reads appear to be random sequences not used in indexes.

Has anyone ever heard of an issue like this? I'm at my wits end here.
bmreilly is offline   Reply With Quote
Old 04-10-2019, 04:05 PM   #2
jdk787
josh kinman
 
Location: Austin

Join Date: Apr 2014
Posts: 63
Default

The I5 index chemistry for the HiSeqX is different from the NovaSeq. For standard TruSeq style adapters the I5 sequence on the HiSeqX will be the reverse complement of what it is for the NovaSeq.

If your I5 sequences aren't showing up as the reverse complement, my guess is that your adapters/primers don't have an I5 primer binding site that is compatible with the HiSeqX.

https://support.illumina.com/content...5057455-04.pdf
__________________
Josh Kinman
jdk787 is offline   Reply With Quote
Old 04-10-2019, 04:12 PM   #3
bmreilly
Junior Member
 
Location: San Diego

Join Date: Apr 2019
Posts: 2
Default

Quote:
Originally Posted by jdk787 View Post
The I5 index chemistry for the HiSeqX is different from the NovaSeq. For standard TruSeq style adapters the I5 sequence on the HiSeqX will be the reverse complement of what it is for the NovaSeq.

If your I5 sequences aren't showing up as the reverse complement, my guess is that your adapters/primers don't have an I5 primer binding site that is compatible with the HiSeqX.

https://support.illumina.com/content...5057455-04.pdf
What do you mean by "your adapters/primers don't have an I5 primer binding site that is compatible with the HiSeqX" ? is it possible for these same libraries and primers to work on the NovaSeq but be completely incompatible on the HiSeqX?

I know that you need an i5 primer for the HiSeq X which wouldn't be necessary on the novaseq because the nova has the grafted p5 oligo, but its unclear to me whether if you used the standard HP11 or whatever i5 index primer why it wouldn't work on the HiSeq X?
bmreilly is offline   Reply With Quote
Old 04-10-2019, 04:49 PM   #4
jdk787
josh kinman
 
Location: Austin

Join Date: Apr 2014
Posts: 63
Default

Quote:
Originally Posted by bmreilly View Post
What do you mean by "your adapters/primers don't have an I5 primer binding site that is compatible with the HiSeqX" ? is it possible for these same libraries and primers to work on the NovaSeq but be completely incompatible on the HiSeqX?
Yes, I have actually designed custom dual index primers that work on our MiSeq (NovaSeq style) but not on our MiniSeq (HiSeqX style).

Quote:
I know that you need an i5 primer for the HiSeq X which wouldn't be necessary on the novaseq because the nova has the grafted p5 oligo, but its unclear to me whether if you used the standard HP11 or whatever i5 index primer why it wouldn't work on the HiSeq X?
I would first look at your I5 oligo sequence and compare it to Illumina's.
https://support.illumina.com/content...0002694-09.pdf

TruSeq
AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Nextera
AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC

If it matches one of these then you should be fine, but if not your oligo may not be compatible with platforms that use the same index chemistry as the HiSeqX.
__________________
Josh Kinman
jdk787 is offline   Reply With Quote
Reply

Tags
hiseq x, index sequence

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:56 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO