SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Oxford Nanopore



Similar Threads
Thread Thread Starter Forum Replies Last Post
Input DNA requirement for MinION HMorrison Oxford Nanopore 1 09-18-2015 12:59 PM
PacBio vs MinION BioKiwi Bioinformatics 7 06-23-2015 01:48 AM
2-hour run on Oxford Nanopore MinION gringer Bioinformatics 0 09-09-2014 05:15 AM

Reply
 
Thread Tools
Old 10-15-2015, 09:28 AM   #1
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default files geberated by MinIon

Hello,
I want to know is this the Minion sequencing generates two files as Illumina (paired end) of the first brain DNA (file1_R1) and second brain (file2_R2) its complement?

thankyou
mido1951 is offline   Reply With Quote
Old 10-15-2015, 09:48 AM   #2
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

No, it generates a single file with 1D reads (those that were read once) and 2D reads (those that were read both forward and reverse, which are presented as a single consensus sequence).
Brian Bushnell is offline   Reply With Quote
Old 10-15-2015, 09:51 AM   #3
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

So the only file present forward and reverse ? or a single brain?
mido1951 is offline   Reply With Quote
Old 10-15-2015, 10:05 AM   #4
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

I'm not sure what you mean by brain. There is one output file, and it contains unpaired reads.
Brian Bushnell is offline   Reply With Quote
Old 10-15-2015, 10:08 AM   #5
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

I think @mid01951 is referring to "strand"?
GenoMax is offline   Reply With Quote
Old 10-15-2015, 10:27 AM   #6
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

excuse me. Yes, brain is strand.
I mean the file has only one strand? not like Illummina, the two strand present it in two files?
mido1951 is offline   Reply With Quote
Old 10-15-2015, 10:35 AM   #7
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

Per Brian's answer in #2, the file has one sequence per read. If it happens to be a 2D read then the sequence is consensus of the two reads from the two strands.
GenoMax is offline   Reply With Quote
Old 10-19-2015, 01:45 PM   #8
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

Thanks for your help.
But I want to know how Minion generates a sequence from the two strand?
mido1951 is offline   Reply With Quote
Old 10-19-2015, 03:35 PM   #9
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

Quote:
Originally Posted by mido1951 View Post
Thanks for your help.
But I want to know how Minion generates a sequence from the two strand?
https://www.youtube.com/watch?v=CE4dW64x3Ts
GenoMax is offline   Reply With Quote
Old 10-27-2015, 02:37 PM   #10
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default MinIon reads

Hello,
I want to know more about the method of sequencing Minion.
I read sequencing method and according to my understanding, MinION read the entire DNA fragment in both directions and produces a sequence consensus "2D".
I want to make an example.
we suppose this DNA fragment: image attached

So the consensus sequence(read from MinIon) is:

ATGAGGATCAGCCGCAAGCGGAATACTGCCTAGTCGGCGTTCGCCTT

am i right?
thanks
Attached Images
File Type: png adb.png (4.8 KB, 25 views)
mido1951 is offline   Reply With Quote
Old 10-27-2015, 07:38 PM   #11
AllSeq
Registered Vendor
 
Location: San Diego, CA

Join Date: Oct 2013
Posts: 138
Default

No, not quite. 2D reads are from double stranded molecules with a hairpin on one end. So if it starts reading from the 5' end, it would continue reading both strands from 5' to 3' (unless that's backwards and the enzyme processes in the other direction - 3' to 5'). This would yield the following sequence:

ATGAGGATCAGCCGCAAGCGGAA*TTCCGCTTGCGGCTGATCCGTCAT

Where "*" would be some sort of hairpin sequence.

But this isn't a 'consensus sequence' - the consensus sequence would be built up from multiple 2D reads.
__________________
AllSeq - The Sequencing Marketplace
info@AllSeq.com
www.AllSeq.com
AllSeq is offline   Reply With Quote
Old 10-28-2015, 04:44 AM   #12
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

thank you for your explanations.
I say "consensus sequence"that is the read generated by this DNA fragment (this is just an example to understand the sequencing method Minion)

So the read is: ATGAGGATCAGCCGCAAGCGGAATTCCGCTTGCGGCTGATCCGTCAT

am I right?

THanks
mido1951 is offline   Reply With Quote
Old 10-28-2015, 07:00 AM   #13
Chipper
Senior Member
 
Location: Sweden

Join Date: Mar 2008
Posts: 324
Default

No, the 2d read would be ATGAGGATCAGCCGCAAGCGGAA (or as close as it gets given the error rate). In this case ATGAGGATCAGCCGCAAGCGGAA would also be given as the forward (template) read, and TTCCGCTTGCGGCTGATCCGTCAT the reverse read.
Chipper is offline   Reply With Quote
Old 10-28-2015, 07:55 AM   #14
mido1951
Senior Member
 
Location: Tunisia

Join Date: May 2014
Posts: 123
Default

but the sequencer generates a single Minion read.
there is no foward and reverse just one read.
am i right?
mido1951 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:45 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO