SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie: Ultrafast and memory-efficient alignment of short reads to the human genome Ben Langmead Literature Watch 2 03-04-2013 02:06 AM
converting maq .map or mapview files to SINGLE-END mapview nazanin Bioinformatics 1 01-30-2011 11:02 PM
Slider - Maximum use of probability information for alignment of short sequence reads ECO Bioinformatics 17 09-21-2010 04:35 PM
SAMTools alignment viewer Fred13 Bioinformatics 0 11-30-2009 05:09 AM
Haman genome alignment with short reads ptongyoo Bioinformatics 4 04-14-2009 05:27 PM

Reply
 
Thread Tools
Old 03-01-2009, 05:26 AM   #21
seq_GA
Senior Member
 
Location: Asiana

Join Date: Feb 2009
Posts: 124
Default

Hi P
I am interested to use the tool.
Please let me know whether to use eland_multi or eland_export or eland_sorted file to use as the input file?
My second question is whether I can view only solexa single run and not the pair end reads?
Thanks.
seq_GA is offline   Reply With Quote
Old 03-01-2009, 08:21 PM   #22
baohua100
Senior Member
 
Location: Canada

Join Date: Jun 2008
Posts: 103
Default

Quote:
Originally Posted by seq_GA View Post
Hi P
I am interested to use the tool.
Please let me know whether to use eland_multi or eland_export or eland_sorted file to use as the input file?
My second question is whether I can view only solexa single run and not the pair end reads?
Thanks.
input file:
1. Reference sequence file (contains single sequence) and
2. Eland formated alignment results file like this:
I326_2_FC306FCAAXX:8:1:211:212 GATTTATCATGTAAGAGGTTGTCATTCAGAATGGT U0 1 0 0 4 chr1 R
I326_2_FC306FCAAXX:8:1:913:158 GAAAAAGGAACCTCTGCAGACATATCATGCAACTG U0 1 0 0 164 chr1 R
I326_2_FC306FCAAXX:8:1:183:435 GGGAGATTCCCATATCTTTTCCACTTTCCTCTTCC U0 1 0 0 530 chr1 F

you can covert these 2 files to a MVF file in MapView, then open the MVF file to view results.


If the reference file or alignment results file contains multiple reference sequence id, then you can click Splitter to split the file into multiple files and one file only contains only one reference id.
baohua100 is offline   Reply With Quote
Old 03-02-2009, 07:57 AM   #23
bioinfosm
Senior Member
 
Location: USA

Join Date: Jan 2008
Posts: 482
Default

Quote:
Originally Posted by baohua100 View Post
Now we add ZOOM IN/OUT feature to MapView

http://evolution.sysu.edu.cn/software/mapview.htm

In next week mapview can display quality score.
Thats great! I can see this tool becoming really useful
Some very basic things that would be wonderful are things like

- the display as SNP position centered (currently the SNP is at immediate left)
- Auto put the reads in a window to the top of the screen. Its not intuitive to see a blank screen and then scroll down to see reads there
- thresholds for reads in both directions
- zooming out further than 4, to view the bigger landscape, shaded reverse mapped reads and red-font SNPs; and then click to center at any chosen position

Good luck..
bioinfosm is offline   Reply With Quote
Old 03-02-2009, 05:53 PM   #24
baohua100
Senior Member
 
Location: Canada

Join Date: Jun 2008
Posts: 103
Default

The great majority of alignment viewer were designed for loading and processing big assembly file in the ACE format. This memory based design requires huge amount of memory not typically available to desktop computer users.

MapView converts the reference file and alignment result file to a single file in the MapView format (MVF). The MVF binary format, combined with effective compressing and indexing of the aligned reads, will enable reduction in disk usage and quick positioning.

MapView is a disk based viewer and it only loads displayed section of the alignment result into memory. This leads to a small burden on memory resources while not compromising the speed.
baohua100 is offline   Reply With Quote
Old 03-02-2009, 06:03 PM   #25
baohua100
Senior Member
 
Location: Canada

Join Date: Jun 2008
Posts: 103
Default

Quote:
Originally Posted by yasutake View Post
To baofua100,

This must be useful !

I tried to use Mapview but I couldn't understand how to use it.

I'll be happy if you make the tutorial or the manual.

Besides, let me ask some questions.

1. Can map files of MAQ be imported to Mapview directly ?
2. Should I prepare the ref. sequence as a fasta format ?

reference :
>chr1
gaagcgtagtctagtcagcgtagtcgtaactcat

MAQ format:
I326_2_FC306FCAAXX:8:18:1354:1553 chr1 597 - 0 0 99 99 99 0 01 0 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA GGBFPOLQOPLHYRDOCLYM`OO^VSP``YR`_]T
I326_2_FC306FCAAXX:8:22:173:821 chr1 597 - 0 0 99 99 99 0 0 10 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA NHELOUPVTZUT_WU^```````````````````
I326_2_FC306FCAAXX:8:29:309:1409 chr1 597 - 0 0 99 99 99 0 01 0 35 GGTGGGACCGTTCGTGAAGGCTGGCCCATTGAGGA HLHOBQCOOEGTP]LNJXVX`````J`````````

you can input these 2 files to make a mvf format file in mapview.

confirm that there is only one reference id , if there are multiple reference id ,please first use splitter to split the reference and alignment file
baohua100 is offline   Reply With Quote
Old 03-04-2009, 05:40 AM   #26
Aengus
Junior Member
 
Location: london

Join Date: Sep 2008
Posts: 6
Default

Hi guys,

Just after a quick update.

Is the display of quality scores now in the download? The main page still says that the version is 1.0


Regards
Aengus
Aengus is offline   Reply With Quote
Old 03-04-2009, 07:24 AM   #27
guohui
Junior Member
 
Location: China

Join Date: Feb 2009
Posts: 2
Default

To Aengus,

Next version of MapView is in debugging period and will be available soon. The new version will support the display of quality score and pair-end data.
guohui is offline   Reply With Quote
Old 03-05-2009, 02:18 PM   #28
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 693
Default

This sounds very promising! I just wonder if you are interested in natively supporting the SAM/BAM format. I think the 1000genomes project has already released some alignments in the BAM format and yet more to come in the next few months. I know it is trivial to convert SAM/BAM to MVF, but given the large amount of data (maybe >1TB data), most users would prefer viewing the alignment directly rather than duplicate them again. BAM is also compressed and indexable, and supports indels and long alignments. Sorry if this sounds like promoting projects related to myself.
lh3 is offline   Reply With Quote
Old 03-08-2009, 04:31 AM   #29
WJW-Davy
Member
 
Location: China

Join Date: Feb 2009
Posts: 23
Exclamation MapView 3.0 beta1 is being tested...

MapView 3.0 beta2 is being tested.
MapView 3.0 has improved much. Quality Score, Paired-end data, structure variation, coverage distribution, quality distribution, text quick view, zoom in/out, and other features are supported.
__________________
WJW-Davy
HomePage: http://hi.baidu.com/wjwdavy
Download Center: https://sites.google.com/site/wjwdavy/

Last edited by WJW-Davy; 05-05-2009 at 04:37 AM. Reason: add jpg
WJW-Davy is offline   Reply With Quote
Old 03-10-2009, 07:00 AM   #30
WJW-Davy
Member
 
Location: China

Join Date: Feb 2009
Posts: 23
Exclamation Welcome to test MapView 3.1.0.0

MapView is quick and using small memory. Good performance.

MapView is based on .NET Framework. You can try it on Windows (with .NET 2.0 or higher) and Linux (with Mono 2.0 or higher).

Welcome to test MapView 3.1.0.0


Download: http://evolution.sysu.edu.cn/mapview/
__________________
WJW-Davy
HomePage: http://hi.baidu.com/wjwdavy
Download Center: https://sites.google.com/site/wjwdavy/

Last edited by WJW-Davy; 04-07-2009 at 06:30 AM.
WJW-Davy is offline   Reply With Quote
Old 03-19-2009, 07:29 AM   #31
baohua100
Senior Member
 
Location: Canada

Join Date: Jun 2008
Posts: 103
Default

MapView 3.1.2 is released!

If you have some suggestions or bugs, please post here! Thanks!
baohua100 is offline   Reply With Quote
Old 03-19-2009, 09:56 AM   #32
bioinfosm
Senior Member
 
Location: USA

Join Date: Jan 2008
Posts: 482
Default

Thanks baohua.
Whats the changelog? Is there a command-line version using x-windows maybe?
bioinfosm is offline   Reply With Quote
Old 03-19-2009, 10:08 AM   #33
garwuf
Junior Member
 
Location: Russia

Join Date: Mar 2009
Posts: 7
Default indels

First, I would like to thank you guys for this useful tool. I have tried it on several datasets and found its performance to be more than adequate. I have one question: I have noticed that the viewer handles the alignments as ungapped even if I feed it with gapped ones (like soap1 or seqmap outputs). Actually, the very nature of input information for the viewer suggests that it positions only the first base of a read against reference sequence, but not every base. So, I wonder if you have any plans to make Mapview to visualize indels?
garwuf is offline   Reply With Quote
Old 03-21-2009, 07:26 AM   #34
baohua100
Senior Member
 
Location: Canada

Join Date: Jun 2008
Posts: 103
Default

Thanks! bioinform! Sorry, there is not a command-line version using x-windows now.

Quote:
Originally Posted by bioinfosm View Post
Thanks baohua.
Whats the changelog? Is there a command-line version using x-windows maybe?
baohua100 is offline   Reply With Quote
Old 03-21-2009, 07:45 AM   #35
baohua100
Senior Member
 
Location: Canada

Join Date: Jun 2008
Posts: 103
Default

Thanks for your reply! MapView 3.1.2 only support for visualization of ungapped alignment. We will add the function of gapped and spliced alignment later.

Quote:
Originally Posted by garwuf View Post
First, I would like to thank you guys for this useful tool. I have tried it on several datasets and found its performance to be more than adequate. I have one question: I have noticed that the viewer handles the alignments as ungapped even if I feed it with gapped ones (like soap1 or seqmap outputs). Actually, the very nature of input information for the viewer suggests that it positions only the first base of a read against reference sequence, but not every base. So, I wonder if you have any plans to make Mapview to visualize indels?
baohua100 is offline   Reply With Quote
Old 04-01-2009, 09:09 AM   #36
lparsons
Member
 
Location: NJ

Join Date: Nov 2008
Posts: 28
Default

I tried to run MapView using Mono on a Mac OS X 10.5. It started, displayed the window briefly, the crashed with this error:

System.NotImplementedException: The requested feature is not implemented.
at System.Windows.Forms.XplatUICarbon.get_CursorSize () [0x00000]
at System.Windows.Forms.XplatUI.get_CursorSize () [0x00000]
at System.Windows.Forms.SystemInformation.get_CursorSize () [0x00000]
at MapView.Form1.abmmeKAlo (System.Object , System.EventArgs ) [0x00000]
at System.Windows.Forms.Form.OnLoad (System.EventArgs e) [0x00000]
at System.Windows.Forms.Form.OnLoadInternal (System.EventArgs e) [0x00000]
Segmentation fault

Any suggestions? Thanks.
lparsons is offline   Reply With Quote
Old 04-01-2009, 02:05 PM   #37
lparsons
Member
 
Location: NJ

Join Date: Nov 2008
Posts: 28
Default

I ran the software on Windows, and was able to get it running. However, after converting a MAQ alignment to MVF, when I load the MVF file, I get an error:

Arithmetic operation resulted in an overflow.
lparsons is offline   Reply With Quote
Old 04-15-2009, 09:49 PM   #38
baohua100
Senior Member
 
Location: Canada

Join Date: Jun 2008
Posts: 103
Default

The paper is published on Bioinformaitcs.

MapView: visualization of short reads alignment on a desktop computer

http://bioinformatics.oxfordjournals...bstract/btp255
baohua100 is offline   Reply With Quote
Old 04-20-2009, 07:57 AM   #39
bioinfosm
Senior Member
 
Location: USA

Join Date: Jan 2008
Posts: 482
Default

congrats baohua!
It would be great if you could keep a running log of changes for newer versions
bioinfosm is offline   Reply With Quote
Old 04-21-2009, 12:42 AM   #40
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Quote:
Originally Posted by lh3 View Post
. I know it is trivial to convert SAM/BAM to MVF, but given the large amount of data (maybe >1TB data), most users would prefer viewing the alignment directly rather than duplicate them again.
I have to reiterate the point lh3 is making. SAM/BAM format would be great if you could support it, since even people outside of 1000 genomes have generated 100's of GBs of data in SAM/BAM. Also, paired end info, indels, quality scores, complex references, and the ability to add arbitrary annotation and post-alignment "tracks" (maybe interact with a backend database?) would be the killer application.
nilshomer is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:52 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO