SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
CASAVA 1.7 Install Help aligenie Bioinformatics 29 05-23-2014 02:58 AM
Install TopHat chengeng Bioinformatics 14 12-02-2013 07:17 PM
bowtie index problem (bowtie-build and then bowtie-inspect) tgenahmet Bioinformatics 4 09-10-2013 11:51 AM
How to install ALLPATHLG? skblazer Bioinformatics 0 01-12-2011 11:59 AM
Install TopHat knoto Bioinformatics 0 11-05-2009 02:46 AM

Reply
 
Thread Tools
Old 04-20-2015, 03:16 AM   #161
kaps
Member
 
Location: Uganda

Join Date: Jan 2015
Posts: 71
Default

Ok.

Have proceeded with the downstream tools hoping to visualize the results as below: samtools mpileup -u -f cowpea4RNAseq_ind.fa lib4seq.sorted.bam | bcftools view -cvg -> lib4seq.raw.bcf

but the response is as follows:

[fai_load] build FASTA index.
[fai_build_core] inlined empty line is not allowed in sequence 'gi|325930233|gb|JF427592.1|'.
[fai_load] fail to open FASTA index.
-bash: bcftools: command not found

Not sure where I am going wrong!
kaps is offline   Reply With Quote
Old 04-20-2015, 03:38 AM   #162
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,982
Default

If you want to visualize the alignments then use Integrated Genomics Viewer: http://www.broadinstitute.org/igv/ You have to sort and index your BAM file (which you seem to have done). Cowpea genome is not going to be included IGV so you will need to supply a fasta (make a note) formatted file of the genome sequence to IGV. Use the same file you used for making the bowtie2 indexes.

As for the error above "bcftools" is a program from samtools package. It is included in the source and needs to be compiled (if your administrators have not done so ask them to do that). Only required if you are going to do SNP calling.
GenoMax is offline   Reply With Quote
Old 04-20-2015, 04:32 AM   #163
kaps
Member
 
Location: Uganda

Join Date: Jan 2015
Posts: 71
Default

Any additional clues on how to run igv (igv or igvtools?)?
kaps is offline   Reply With Quote
Old 04-20-2015, 04:40 AM   #164
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,982
Default

Are you having trouble using IGV? If you are running it from the server you will need to use X11/X-Windows. http://www.broadinstitute.org/igv/UserGuide

BTW: Start creating a new thread when you have new questions. The current questions are no longer related to the parent thread.
GenoMax is offline   Reply With Quote
Old 05-22-2015, 05:54 AM   #165
kaps
Member
 
Location: Uganda

Join Date: Jan 2015
Posts: 71
Default

Quote:
Originally Posted by GenoMax View Post
Use the server for all your work. With just 2G of RAM the local computer should only be used to access the server.

I am going to point you to a guide about how to use bowtie2: http://homer.salk.edu/homer/basicTutorial/mapping.html.

You will need a multi-fasta formatted file for your virus sequences (blast db files are not usable).

Broad steps:

1. Create an index for your virus sequences (bowtie2-build). This is what you are going to search against.

Code:
$ /path_to/bowtie2-build virus.fa VIR
VIR would become the "basename" for the bowtie2 index.

2. Start with trimmed/qc'ed fastq data.
3. Do the alignments (bowtie2) and save results in sam format file.

Single-end reads

Code:
$ /path_to/bowtie2 -p 2 -x VIR -U sample1_file.fastq -S sample1.sam
Paired-end reads

Code:
$ /path_to/bowtie2 -p 2 -x VIR -1 sample1_R1_file.fastq -2 sample1_R2_file.fastq -S sample1.sam
-p 2 is number of cores used for search. Keep to <= 4 for now. Provide "basename" (VIR) for index for -x option. Do not include file extensions.

4. Use samtools to "view/sort/index" sam file to bam format.
5. Evaluate the bam file.
Hello,
Why would bowtie abort with such a command?

bowtie2 -p 2 -x CABFG -U clc_trim_pair4.fq -S S4_clc_trm.sam
Error: Read No_name has more quality values than read characters.
terminate called after throwing an instance of 'int'
(ERR): bowtie2-align died with signal 6 (ABRT)
kaps is offline   Reply With Quote
Old 05-22-2015, 06:02 AM   #166
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,982
Default

Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?

Code:
$ head -6 clc_trim_pair4.fq
GenoMax is offline   Reply With Quote
Old 05-22-2015, 06:09 AM   #167
kaps
Member
 
Location: Uganda

Join Date: Jan 2015
Posts: 71
Default

Quote:
Originally Posted by GenoMax View Post
Post a few lines from clc_trim_pair4.fq. Are you getting that error right away?

Code:
$ head -6 clc_trim_pair4.fq
This is what I get:
@No_name
CAACATTACCTAGTGCAAGACAGTGTTAATTTGAAGGCAGTTCATA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@No_name
TTTTTTTTTTTTTTTTCTTTTCTCAACTTCCTTCACCTTCACACTCTCTTTCCCTTCTTC
kaps is offline   Reply With Quote
Old 05-22-2015, 06:22 AM   #168
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,982
Default

Is that all the sequence in the file? Just one record?

If not, are all sequences called "NO_name"? That is not going to work since the names are not unique.

Post output of.

Code:
$ ls -lh clc_trim_pair4.fq
GenoMax is offline   Reply With Quote
Old 08-13-2015, 07:41 AM   #169
sandia
Junior Member
 
Location: Livermore

Join Date: Jun 2015
Posts: 3
Default

Hi all,
I've been trying to download Bowtie2.2.5 for Mac and followed instructions on this forum. The consistent error message I've been getting is: (ERR): Expected bowtie2 to be in same directory with bowtie2-align: /Applications/bowtie2-2.2.5/
I've followed suggestions from others with this problem to address this and I've realized that bowtie2-align is not in the folder I am downloading. Is this normal? Do I need to retrieve it elsewhere? I assume I am missing something basic since I am new to all this. Thanks in advance for any help.
sandia is offline   Reply With Quote
Old 08-13-2015, 09:23 AM   #170
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,982
Default

bowtie2 web site appears to be experiencing issues at the moment (can't get to the 2.2.6 code). Are you downloading the pre-compiled binary zip file for OS X from this link: http://sourceforge.net/projects/bowt...owtie2/2.2.5/? After uncompressing the archive all files you need should be in the uncompressed folder.
GenoMax is offline   Reply With Quote
Old 08-13-2015, 09:40 AM   #171
sandia
Junior Member
 
Location: Livermore

Join Date: Jun 2015
Posts: 3
Default

Thanks for the reply. Yes I've downloaded that file but it does not contain bowtie2-align.
sandia is offline   Reply With Quote
Old 08-13-2015, 09:47 AM   #172
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,982
Default

I just checked the zip archive and the executables are all there (there are multiple align versions, bowtie2-align-l,bowtie2-align-s etc). You should run bowtie2 like so

Code:
$ bowtie2 -help
GenoMax is offline   Reply With Quote
Old 08-13-2015, 09:58 AM   #173
sandia
Junior Member
 
Location: Livermore

Join Date: Jun 2015
Posts: 3
Default

Got it, thank you!
sandia is offline   Reply With Quote
Reply

Tags
bowtie

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:42 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO