SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Process to remove primers, adapters, etc. from Illumina data LizBent Bioinformatics 6 05-14-2012 05:08 AM
how to remove 3'-adaptor sequence from illumina DGE expression data archory Illumina/Solexa 0 11-29-2011 06:53 PM
Illumina adaptor sequence filter slny Bioinformatics 1 04-21-2011 01:25 PM
Remove adapter sequence vini SOLiD 1 04-13-2011 10:28 AM
How to trim the adaptor sequence from the solexa small RNA sequencing data? satp Bioinformatics 11 11-17-2010 02:08 PM

Reply
 
Thread Tools
Old 11-29-2011, 01:40 AM   #1
archory
Junior Member
 
Location: singapore

Join Date: Nov 2011
Posts: 4
Default how to remove 3'-adaptor sequence from illumina DGE expression data

I got the raw illumina DGE expression data in FASTQ format, and trying to remove the 3'-adaptor sequence from it.

here is samples of the raw data I got from the sequencing company
@FC81M3VABXX:4:1101:1130:2169#0/1
GGATCTGGTTGGGTTATCCAGTACTTCTCGTATGGCGTCTTCTGCTTGA
+
eceaeedec_bddI_c^bccebUecRc^cXXZ__L^BBBBBBBBBBBBB
@FC81M3VABXX:4:1101:1110:2188#0/1
TTCAGGTGGTTTCTTCTCCAGTACTTCTCGTATGCCGTCTTCTGCTTGA
+
gggggfdffdgggggggggdgggggggggedfeefffdfefd^aeefa^
@FC81M3VABXX:4:1101:1184:2239#0/1
GAACATCACTGTAGACTTCCAGTACTTCTCGTATGCCGTCTTCTGCTTG
+
fffffffffffefMfdddddffeffffeffe[db[eedbceecececd^

I can find the Gex Adapter 2 for NlaIII gene expression (TCGTATGCCGTCTTCTGCTTG) at the end of the sequence, but the problem is that the tag sequence shall be just 17bp and the remaining sequences doesn't seem to match the adapter 1.
anyone knows how to get the correct tag sequences from the sample fastq above?

many thanks!
archory is offline   Reply With Quote
Old 11-29-2011, 12:47 PM   #2
Nicolas
Member
 
Location: new york city

Join Date: Apr 2009
Posts: 40
Default

Did you try fastx_toolkit? It contains a script fastx_clipper that identify the 3'adapter and remove it. It allows for some mismatches and should correspond to what you're looking for.
http://hannonlab.cshl.edu/fastx_toolkit/
Nicolas is offline   Reply With Quote
Old 11-29-2011, 06:50 PM   #3
archory
Junior Member
 
Location: singapore

Join Date: Nov 2011
Posts: 4
Default

thanks for the recommendation and I will try it
archory is offline   Reply With Quote
Old 11-30-2011, 04:20 AM   #4
kga1978
Senior Member
 
Location: Boston, MA

Join Date: Nov 2010
Posts: 100
Default

I found this only yesterday - really nice tool:
http://www.usadellab.org/cms/index.php?page=trimmomatic
kga1978 is offline   Reply With Quote
Old 11-30-2011, 05:02 AM   #5
kalyankpy
PostDoc
 
Location: Turku, Finland

Join Date: Mar 2010
Posts: 20
Default Cutadapt

I have used Cutadapt (code.google.com/p/cutadapt/). I liked this tool as it allows user to define and fine tune each of the parametre. You can also allow errors in identifying the adapters. If in case you want to check the 5' adapters, this will be a tool of choice as you can specify where to search the adapter (3' or 5' or anywhere).
kalyankpy is offline   Reply With Quote
Old 11-30-2011, 07:05 PM   #6
archory
Junior Member
 
Location: singapore

Join Date: Nov 2011
Posts: 4
Default

thanks for the reply and I will try them first and see how things going
archory is offline   Reply With Quote
Old 12-05-2011, 07:55 AM   #7
maasha
Senior Member
 
Location: Denmark

Join Date: Apr 2009
Posts: 153
Default

Biopieces got find_adaptor which allows removal of partial adaptor sequence:

http://code.google.com/p/biopieces/wiki/find_adaptor
maasha is offline   Reply With Quote
Reply

Tags
dge adaptor remove

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:48 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO