SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
cufflinks error polsum Bioinformatics 2 11-30-2011 03:54 PM
possible error in cufflinks? dnusol Bioinformatics 0 03-07-2011 09:53 AM
Cufflinks error ameyer Bioinformatics 1 03-04-2011 05:07 AM
an error when using cufflinks masylichu Bioinformatics 4 12-18-2010 04:15 PM

Reply
 
Thread Tools
Old 02-07-2011, 01:57 PM   #1
brachysclereid
Member
 
Location: California

Join Date: Feb 2011
Posts: 32
Default Cufflinks error

When running cufflinks I get the following error:

$ cufflinks -G annotation.gtf ./s_1/accepted_hits.bam
cufflinks: /usr/lib64/libz.so.1: no version information available (required by cufflinks)
Error: sort order of reads in BAMs must be the same

I am using TopHat v1.1.4 to create the BAMs with bowtie indexes.
The cufflinks version is cufflinks v0.9.3.

Based on previous posts I tried reverting from the BAM to SAM, but got the same result.

Any ideas? Thanks!
brachysclereid is offline   Reply With Quote
Old 02-25-2011, 09:32 AM   #2
jgarbe
Member
 
Location: Saint Paul, MN

Join Date: Mar 2010
Posts: 13
Default Same here

I've run into the same issue...
jgarbe is offline   Reply With Quote
Old 02-28-2011, 04:42 AM   #3
ameyer
Member
 
Location: Toronto, ON

Join Date: Jan 2011
Posts: 23
Default Me too

I've had this error as well. I emailed the help email address and they said it's a rare issue with the software where the contig names have hash collisions. The problem should be fixed when they release Cufflinks v1.0.
ameyer is offline   Reply With Quote
Old 02-28-2011, 05:58 AM   #4
brachysclereid
Member
 
Location: California

Join Date: Feb 2011
Posts: 32
Default cufflinks version 1.0

Thanks for the information. Did they mention when they would release that version?
brachysclereid is offline   Reply With Quote
Old 02-28-2011, 08:03 AM   #5
Aurelien Mazurie
Member
 
Location: Bozeman, MT

Join Date: Feb 2011
Posts: 15
Default

I had exactly the same problem; sorting the BAM file didn't help.
Aurelien Mazurie is offline   Reply With Quote
Old 03-01-2011, 06:39 AM   #6
ameyer
Member
 
Location: Toronto, ON

Join Date: Jan 2011
Posts: 23
Default

Tech support was able to find the cause of my error in my SAM file. In the header section I had some colons as part of my contig names that messed up Cufflinks. By removing the colons in the header and throughout the file I stopped getting this error.
Originally I had:
@SQ SN:chromosome:AGPv2:1:1:301354135:1 LN:301354135
and this changed to:
@SQ SN:chromosome1 LN:301354135

Hope this helps.

Last edited by ameyer; 03-01-2011 at 06:45 AM.
ameyer is offline   Reply With Quote
Old 03-01-2011, 07:45 AM   #7
Aurelien Mazurie
Member
 
Location: Bozeman, MT

Join Date: Feb 2011
Posts: 15
Default

Interesting. I checked my SAM files, and the @SQ lines only have two colons:

@HD VN:1.0 SO:sorted
@SQ SN:EG:bd_7x3 LN:450
@SQ SN:EG:bd_6x3 LN:450
@SQ SN:EG:bd_36x35 LN:554
@SQ SN:EG:bd_55x36 LN:808
@SQ SN:EG:bd_54x36 LN:1351
@SQ SN:EG:bd_16x14 LN:1992
@SQ SN:EG:bd_53x36 LN:2027
@SQ SN:EG:bd_52x36 LN:2040
@SQ SN:EG:bd_51x36 LN:2113
@SQ SN:EG:bd_37x35 LN:2489
. . .

From your experience, is that enough to trigger the error?

What about the reads references after that? Mine do contain a lot of colons. Did you have to modify them to? E.g.,

@PG ID:TopHat VN:1.2.0 CL:../Applications/tophat/1.2.0/tophat -o ./2_run_TopHat/JV-
A_on_Phatr-ENSEMBL-unmasked --num-threads 4 -G ../Data/Genome/ENSEMBL/Phaeodactylum_tricornutum.Phat
r2.61.gtf ./1_create_Bowtie_index/Phatr-ENSEMBL-unmasked ../Data/Expression/2011.02.02/JV-A.fastq
SNPSTER7_0744:2:33:16520:18860#0 16 EG:bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1
SNPSTER7_0744:2:58:18789:10460#0 16 EG:bd_6x3 6 255 54M * 0 0 GGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTCG [ffffc_ccfffWcZ\Z\ZYT_NYcfaaf
ffcfccff]fffccffffafffafc NM:i:0 NH:i:1
. . .
Aurelien Mazurie is offline   Reply With Quote
Old 03-01-2011, 07:51 AM   #8
ameyer
Member
 
Location: Toronto, ON

Join Date: Jan 2011
Posts: 23
Default

The only colons that are allowed in the @SQ lines are the ones directly after SN and LN so the one you have between EG and bd would have to be removed. It would also have to be removed in all the read references so that the the names match each other.
So for example you would have:
@SQ SN:bd_6x3 LN:450
and:
SNPSTER7_0744:2:33:16520:18860#0 16 bd_6x3 5 255 54M * 0 0 TGGAAATCTAAAGTTCACGATACACCAATCATTCAGTCTGAGGTTGATACTTTC hhhhhhehhhhhhfffdaedfdfbhfhhg
hhfhhhhhhfhhghghhhhhfffff NM:i:0 NH:i:1
ameyer is offline   Reply With Quote
Old 03-01-2011, 09:41 AM   #9
Aurelien Mazurie
Member
 
Location: Bozeman, MT

Join Date: Feb 2011
Posts: 15
Default

It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

Aurelien
Attached Files
File Type: txt fix_SAM.py.txt (1.2 KB, 123 views)
Aurelien Mazurie is offline   Reply With Quote
Old 06-30-2011, 09:30 AM   #10
delphi_ote
Junior Member
 
Location: Champaign, IL

Join Date: Oct 2010
Posts: 9
Default

Quote:
Originally Posted by Aurelien Mazurie View Post
It works, thanks! For those interested I wrote a Python script to do the job, which is enclosed.

Aurelien
Your script just saved my bacon. Thank you SO much for this!!!
delphi_ote is offline   Reply With Quote
Old 02-08-2017, 04:05 AM   #11
eieneg
Junior Member
 
Location: Europe

Join Date: Feb 2017
Posts: 5
Default

COLONS in the fasta and GFF!!!!!
eieneg is offline   Reply With Quote
Reply

Tags
cufflinks

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:02 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO