
Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa

Similar Threads
Thread Thread Starter Forum Replies Last Post
Process to remove primers, adapters, etc. from Illumina data LizBent Bioinformatics 6 05-14-2012 05:08 AM
how to remove 3'-adaptor sequence from illumina DGE expression data archory Bioinformatics 6 12-05-2011 07:55 AM
Illumina adaptor sequence filter slny Bioinformatics 1 04-21-2011 01:25 PM
Remove adapter sequence vini SOLiD 1 04-13-2011 10:28 AM
How to trim the adaptor sequence from the solexa small RNA sequencing data? satp Bioinformatics 11 11-17-2010 02:08 PM

Thread Tools
Old 11-29-2011, 06:53 PM   #1
Junior Member
Location: singapore

Join Date: Nov 2011
Posts: 4
Default how to remove 3'-adaptor sequence from illumina DGE expression data

I got the raw illumina DGE expression data in FASTQ format, and trying to remove the 3'-adaptor sequence from it.

here is samples of the raw data I got from the sequencing company

I can find the Gex Adapter 2 for NlaIII gene expression (TCGTATGCCGTCTTCTGCTTG) at the end of the sequence, but the problem is that the tag sequence shall be just 17bp and the remaining sequences doesn't seem to match the adapter 1.
anyone knows how to get the correct tag sequences from the sample fastq above?

many thanks!
archory is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 06:08 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO