how to remove 3'-adaptor sequence from illumina DGE expression data

archory · 11-29-2011, 06:53 PM

I got the raw illumina DGE expression data in FASTQ format, and trying to remove the 3'-adaptor sequence from it.

here is samples of the raw data I got from the sequencing company
@FC81M3VABXX:4:1101:1130:2169#0/1
GGATCTGGTTGGGTTATCCAGTACTTCTCGTATGGCGTCTTCTGCTTGA
+
eceaeedec_bddI_c^bccebUecRc^cXXZ__L^BBBBBBBBBBBBB
@FC81M3VABXX:4:1101:1110:2188#0/1
TTCAGGTGGTTTCTTCTCCAGTACTTCTCGTATGCCGTCTTCTGCTTGA
+
gggggfdffdgggggggggdgggggggggedfeefffdfefd^aeefa^
@FC81M3VABXX:4:1101:1184:2239#0/1
GAACATCACTGTAGACTTCCAGTACTTCTCGTATGCCGTCTTCTGCTTG
+
fffffffffffefMfdddddffeffffeffe[db[eedbceecececd^

I can find the Gex Adapter 2 for NlaIII gene expression (TCGTATGCCGTCTTCTGCTTG) at the end of the sequence, but the problem is that the tag sequence shall be just 17bp and the remaining sequences doesn't seem to match the adapter 1.
anyone knows how to get the correct tag sequences from the sample fastq above?

many thanks!

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Process to remove primers, adapters, etc. from Illumina data	LizBent	Bioinformatics	6	05-14-2012 05:08 AM
how to remove 3'-adaptor sequence from illumina DGE expression data	archory	Bioinformatics	6	12-05-2011 07:55 AM
Illumina adaptor sequence filter	slny	Bioinformatics	1	04-21-2011 01:25 PM
Remove adapter sequence	vini	SOLiD	1	04-13-2011 10:28 AM
How to trim the adaptor sequence from the solexa small RNA sequencing data?	satp	Bioinformatics	11	11-17-2010 02:08 PM

11-29-2011, 06:53 PM	#1
archory Junior Member Location: singapore Join Date: Nov 2011 Posts: 4	how to remove 3'-adaptor sequence from illumina DGE expression data I got the raw illumina DGE expression data in FASTQ format, and trying to remove the 3'-adaptor sequence from it. here is samples of the raw data I got from the sequencing company @FC81M3VABXX:4:1101:1130:2169#0/1 GGATCTGGTTGGGTTATCCAGTACTTCTCGTATGGCGTCTTCTGCTTGA + eceaeedec_bddI_c^bccebUecRc^cXXZ__L^BBBBBBBBBBBBB @FC81M3VABXX:4:1101:1110:2188#0/1 TTCAGGTGGTTTCTTCTCCAGTACTTCTCGTATGCCGTCTTCTGCTTGA + gggggfdffdgggggggggdgggggggggedfeefffdfefd^aeefa^ @FC81M3VABXX:4:1101:1184:2239#0/1 GAACATCACTGTAGACTTCCAGTACTTCTCGTATGCCGTCTTCTGCTTG + fffffffffffefMfdddddffeffffeffe[db[eedbceecececd^ I can find the Gex Adapter 2 for NlaIII gene expression (TCGTATGCCGTCTTCTGCTTG) at the end of the sequence, but the problem is that the tag sequence shall be just 17bp and the remaining sequences doesn't seem to match the adapter 1. anyone knows how to get the correct tag sequences from the sample fastq above? many thanks!