SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Is there a program to error check / clean up FASTQ files? marcovth Bioinformatics 1 11-04-2011 08:29 AM
Quality Check for Illumina Sequencing Santosh Illumina/Solexa 1 06-30-2011 08:35 AM
how to check peak quality of chip seq data repinementer Bioinformatics 3 07-04-2010 11:01 PM
how to check the quality of RNASEQ data repinementer Bioinformatics 1 05-18-2010 11:09 PM
Library quality check using known genes alere Sample Prep / Library Generation 0 05-28-2009 03:58 AM

Reply
 
Thread Tools
Old 11-22-2010, 07:24 AM   #1
feng
Member
 
Location: US

Join Date: Oct 2010
Posts: 50
Default fastq quality check with Q=33 or Q=64?

Hi all,

I'm trying do quality checking with FASTX toolkit,
http://hannonlab.cshl.edu/fastx_tool...y_filter_usage

Now I'm confused with different fastq. I list some samples as following, Is there anyone know which Q (33/64) I should used for data analysis?

@SRR036482.94 SOLEXA8_1:2:1:0:1735 length=51
AAAATAAAATATTGGCACAAAGAGATTTCAAAAATATCACTGCATCCTATA
+SRR036482.94 SOLEXA8_1:2:1:0:1735 length=51
=HCHHHEC@EHHHHHHHHDCGGBGHHHHHFHHHHHEEHHHHHFHHHHHHHD
@SRR036482.95 SOLEXA8_1:2:1:1:1455 length=51
ATTATAGAAAGCCAGAGGGAACTAATCACTTCAGTGCAACTGCAGCAGGTA
+SRR036482.95 SOLEXA8_1:2:1:1:1455 length=51
HHDDC=C7?D??DDD8ECC0ACGEGHHEDHHEHE@A8GC?:C4;D=CA@53

Many thanks.
feng is offline   Reply With Quote
Old 11-22-2010, 07:58 AM   #2
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 620
Default

This definitely looks like Sanger quality values (Phred+33).

See FastQ for more information on the FastQ data format.
fkrueger is offline   Reply With Quote
Old 11-22-2010, 12:38 PM   #3
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,172
Default

fkrueger is correct, they are Sanger (Phred+33) encodings. The accession numbers (SRR) indicate that this is data downloaded from the the NCBI SRA. SRA data will always be Phred+33.
kmcarr is offline   Reply With Quote
Old 04-25-2012, 10:39 AM   #4
aloliveira
Member
 
Location: Brazil

Join Date: Aug 2010
Posts: 47
Default

Feng,


How are you? There is an excelent paper that describes the FASTQ encoding. But kmcarr is correct, all the FASTQ sequences from ncbi are Phred+33.

http://www.ncbi.nlm.nih.gov/pubmed/20015970
aloliveira is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:06 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO