
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie, an ultrafast, memory-efficient, open source short read aligner Ben Langmead Bioinformatics 513 05-14-2015 03:29 PM
Introducing BBMap, a new short-read aligner for DNA and RNA Brian Bushnell Bioinformatics 24 07-07-2014 10:37 AM
Miso's open source joyce kang Bioinformatics 1 01-25-2012 07:25 AM
Targeted resequencing - open source stanford_genome_tech Genomic Resequencing 3 09-27-2011 04:27 PM
EKOPath 4 going open source dnusol Bioinformatics 0 06-15-2011 02:10 AM

Thread Tools
Old 07-25-2018, 05:24 PM   #641
Junior Member
Location: San Francisco, CA

Join Date: Apr 2014
Posts: 1
Default Add hg19 masked reference to distribution

I'm using BBTools via bioconda and the corresponding docker container. The image has the necessary resources, e.g. the adapters fasta file:

 Wed 25 Jul - 17:10  ~/code/tick-genome/reflow   origin ☊ master 9☀ 1● 
  docker run -it -v $PWD:/data bash
bash-4.2# find . -name adapters.fa
bash-4.2# cd ./usr/local/opt/bbmap-38.06/resources
bash-4.2# ll
bash: ll: command not found
bash-4.2# ls 
adapters.fa                          blacklist_silva_species_500.sketch   lambda.fa.gz                         nextera_LMP_linker.fa.gz             primes.txt.gz                        sequencing_artifacts.fa.gz
adapters_no_transposase.fa.gz        contents.txt                         lfpe.linker.fa.gz                    pJET1.2.fa                           remote_files.txt                     short.fa
blacklist_img_species_300.sketch     crelox.fa.gz                         mtst.fa                              phix174_ill.ref.fa.gz                remote_files_old.txt                 truseq.fa.gz
blacklist_nt_species_1000.sketch     favicon.ico                          nextera.fa.gz                        phix_adapters.fa.gz                  sample1.fq.gz                        truseq_rna.fa.gz
blacklist_refseq_species_250.sketch  kapatags.L40.fa                      nextera_LMP_adapter.fa.gz            polyA.fa.gz                          sample2.fq.gz
However, the script uses a hardcoded path for the masked human genome posted in the RemoveHuman thread.

	local CMD="java -Djava.library.path=$NATIVELIBDIR $EA $z -cp $CP align2.BBMap minratio=0.9 maxindel=3 bwr=0.16 bw=12 quickmatch fast minhits=2 path=/global/projectb/sandbox/gaag/bbtools/hg19 pigz unpigz zl=6 qtrim=r trimq=10 untrim idtag usemodulo printunmappedcount usejni ztd=2 kfilter=25 maxsites=1 k=14 $@
Can the masked genome be included in the distribution?

Thank you!
olgabot is offline   Reply With Quote
Old 08-07-2018, 08:45 AM   #642
Location: Canada

Join Date: Apr 2013
Posts: 17

Hello Brian,
After running, how can I combine the sequence of the same ID?
for example I want to combine the sequences as following:
m151006_234406_42219_c100867912550000001823195203031665_s1_p0/110457/57769_70466 id=3_0_part_2_6
m151006_234406_42219_c100867912550000001823195203031665_s1_p0/110457/57769_70466 id=3_0_part_3

sunnycqcn is offline   Reply With Quote
Old 08-09-2018, 06:56 AM   #643
Location: Bethesda, MD

Join Date: Oct 2010
Posts: 47
Default pull out sequences with matching primers

Hi Brian,
I was wondering if bbmap has a tool that will pull out reads matching a particular primer sequences? I have fastq files with amplicons from 12 different primers in the same file so i want to make subsets of the reads having specific primers of interest from this.

i have used your tool for other tasks so i figured I would ask if it also has this capability?

Thank you,
JenBarb is offline   Reply With Quote
Old 08-09-2018, 07:08 AM   #644
Senior Member
Location: Bethesda MD

Join Date: Oct 2009
Posts: 505

@JenBarb see this thread in Biostars.
HESmith is offline   Reply With Quote
Old 08-09-2018, 08:09 AM   #645
Location: Bethesda, MD

Join Date: Oct 2010
Posts: 47

Thank you! Love the tool!
JenBarb is offline   Reply With Quote
Old 08-14-2018, 10:05 PM   #646
Location: Japan

Join Date: Sep 2017
Posts: 40

Hoping somebody can help me with this.

I used BBMap and now I would like to extract the reads from by .bam file that are split (/chimeric?) ie. reads that indicate a deletion.

I tried to use samblaster, but it doesn't recognize any reads as split...
(samtools view -h in.bam | samblaster -a -s split.sam -o /dev/null)
Are the split reads marked differently in BBMap compared to other aligners causing samblaster to fail?

IGV shows a good amount of reads with deletions and I can also call deletions using BBTools - so I know they are in there. I just have a feeling callvariants is calling fewer deletions and with lower coverage than what IGV suggests, so I want to check up on it.
Meyana is offline   Reply With Quote
Old 08-15-2018, 10:45 AM   #647
Location: Bethesda, MD

Join Date: Oct 2010
Posts: 47
Default mkf argument in (bbmap tool)

I am trying to use the flag mkf (minkmerfraction) and I am getting an error that that argument does not exist.
sh /data/barbj/bbmap/ in=./../Stool_001-01.fastq outm=v2fstoolfq.fa literal=CTCAAACTTGGGTAATTAAACC k=17 mkf=0.8
java -Djava.library.path=/data/barbj/bbmap/jni/ -ea -Xmx39767m -Xms39767m -cp /data/barbj/bbmap/current/ jgi.BBDukF in=./../Stool_001-01.fastq outm=v2fstoolfq.fa literal=CTCAAACTTGGGTAATTAAACC k=17 mkf=0.8
Executing jgi.BBDukF [in=./../Stool_001-01.fastq, outm=v2fstoolfq.fa, literal=CTCAAACTTGGGTAATTAAACC, k=17, mkf=0.8]

Exception in thread "main" java.lang.RuntimeException: Unknown parameter mkf=0.8
at jgi.BBDukF.<init>(
any ideas why this is not working?

JenBarb is offline   Reply With Quote
Old 08-23-2018, 07:44 AM   #648
Junior Member
Location: Europe

Join Date: Oct 2016
Posts: 2
Default bbmap aborts after mapping some reads

Hello Brian,

we are using bbmap to see in how far it is possible to quantify gene expression by mapping Illumina RNA-seq reads to the genome of a closely related species, e.g. map chimpanzee reads to human or as in this example Macaque reads.

To this end, we generated Macaque Illumina SE reads using flux-simulator and map them to
hg38 and for comparison we were also trying also Mmul8, downloaded from ensembl (wget

Everything mapped fine to hg38, but not to Mmul8.

Exception in thread "Thread-12" java.lang.AssertionError
at align2.BBIndex.extendScore(
at align2.BBIndex.slowWalk3(
at align2.BBIndex.find(
at align2.BBIndex.find(
at align2.BBIndex.findAdvanced(
at align2.AbstractMapThread.quickMap(
at align2.BBMapThread.processRead(

I tried to run on one thread, increased memory to 101G, removed small contigs of <100kb ... but the error message remains the same.

We are running a Debian system with java version "1.8.0_181" and have BBMap version 38.02 -- the detailed error output is in the attached file.

The false Mapping Rates of bbmap are so much better than for STAR & GSNAP, that we definitely want to use bbmap for our paper and we are nearly done all other species (marmoset, gorilla, chimpanzee and orangutan) and the simulations ran through -- the only missing piece is the mapping to the Mmul8.

Any help would be greatly appreciated.

Best, Ines
Attached Files
File Type: txt Mmul1.701837.txt (4.0 KB, 2 views)
ellybelly is offline   Reply With Quote
Old 09-07-2018, 10:24 AM   #649
Location: BC

Join Date: Aug 2010
Posts: 18
Default bbmap for demultiplexing dual barcodes.

I need it if possible to use dual indexes.

For example: In bold dual barcode

#R1 read

#R2 read

Here are 16 possible in the file I am working on.

The first four nts are the barcode like our example before would be:

But you would need both reads to tell you that it's GACT-CTGA and not something else.
What would the command look like for this? Does this demux script do the dual barcoding?
raw937 is offline   Reply With Quote
Old 09-25-2018, 09:01 AM   #650
Junior Member
Location: Europe

Join Date: Sep 2018
Posts: 2
Default ref input for BBMap and paired ends

I am sorry if this question is very basic but I am getting a low percentage of mapping reads to the reference genome, about the 36% of the pct reads mapped. Any clue what this is the case?

I am using as the reference genome the genome in scaffolds and paired-end reads...
juanita is offline   Reply With Quote
Old 09-25-2018, 10:47 AM   #651
Registered Vendor
Location: Eugene, OR

Join Date: May 2013
Posts: 517

Originally Posted by juanita View Post
I am sorry if this question is very basic but I am getting a low percentage of mapping reads to the reference genome, about the 36% of the pct reads mapped. Any clue what this is the case?

I am using as the reference genome the genome in scaffolds and paired-end reads...
Have you trimmed adapters away from the reads (short fragments will create reads that are part genomic and part adapter and may not map). You could use the related BBmap tool sendsketch to get a sense of what is in your reads (after trimming). When we do genotyping of samples, many samples have contaminating using sendsketch can help figure out what is in there. You can input the entire fastq file with sendsketch, or go to read mose and get a result on a per read basis.

You can also grab 100 reads, turn them into fasta format and do blastn with them (if online use the blastn rather than megablast option) and see read by read what is in there.

Other options...your sample is not highly related to the reference, the reference may be incomplete and missing regions, the reference is lacking high copy repeat content like mtDNA or chloroplast and many reads go to those.
Providing nextRAD genotyping and PacBio sequencing services.
SNPsaurus is offline   Reply With Quote
Old 10-11-2018, 08:36 AM   #652
Junior Member
Location: Denver, CO

Join Date: Mar 2009
Posts: 1
Default usejni and compiled C code in BBTools

I just installed the latest version of the BBTools (38.26), and I notice that the C code provided by the usejni=t flag for some tools has been depreciated / disabled.

I found this in the changelog:
Removed JNI path flag from BBMerge, BBMap, and RQCFilter shell scripts.
and this in docs/compiling.txt:
3) C code. This was developed by Jonathan Rood to accelerate BBMap, BBMerge, and Dedupe, but is currently disabled.
Sure enough, it is commented out in the code:
        #local CMD="java -Djava.library.path=$NATIVELIBDIR $EA $z -cp $CP align2.BBMap build=1 overwrite=true fastareadlen=500 $@"
        local CMD="java $EA $z -cp $CP align2.BBMap build=1 overwrite=true fastareadlen=500 $@"
If I revert to the previous version of the CMD, with the java.library.path set, then the command runs with the compiled C code just fine.

Why was this disabled? Does this affect previous analyses that used this C code? That is, does the C code contain an error that means usejni=t in previous versions will produce different output than the java-only code? Or was this purely a performance or compatibility issue, or something else?

Sorry if I've missed this already posted somewhere, and thanks in advance for any help.

csmiller is offline   Reply With Quote
Old 10-24-2018, 08:15 PM   #653
Junior Member
Location: Shanghai, China

Join Date: Oct 2018
Posts: 3

Hi Brian & all,
I'm using BBmap 38.26 with a very big reference genome, and some chromosome in this genome is big enough to break the bbmap ref building session.

Here is the fasta index of this reference:
Chr01 301019445 7 60 61
Chr02 163962470 306036450 60 61
Chr03 261511374 472731635 60 61
Chr04 215701946 738601539 60 61
Chr05 217274494 957898525 60 61
Chr06 219521584 1178794268 60 61
Chr07 222112641 1401974553 60 61
Chr08 153299543 1627789079 60 61
Chr09 238794889 1783643622 60 61
Chr10 205736368 2026418433 60 61
Chr11 220335243 2235583748 60 61
Chr12 229934170 2459591253 60 61
Chr00 714758103 2693357667 60 61
Can see that the longest chromosome is beyond 536670912, which cause a problem like this:
bbmap-38.26/ ref=ref.fasta rebuild=t usemodulo=t -Xmx60g
java -ea -Xmx60g -cp /home/sn/software/bbmap-38.26/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=/home/yangjy/16T4/Genome/GEN181516HEB/_db/Capsicum.annuum.L_Zunla-1_Release_2.0.fasta rebuild=t usemodulo=t -Xmx60g
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=/home/yangjy/16T4/Genome/GEN181516HEB/_db/Capsicum.annuum.L_Zunla-1_Release_2.0.fasta, rebuild=t, usemodulo=t, -Xmx60g]
Version 38.26

No output file.
Writing reference.
Executing dna.FastaToChromArrays2 [/home/yangjy/16T4/Genome/GEN181516HEB/_db/Capsicum.annuum.L_Zunla-1_Release_2.0.fasta, 1, writeinthread=false, genscaffoldinfo=true, retain, waitforwriting=false, gz=true, maxlen=536670912, writechroms=true, minscaf=1, midpad=300, startpad=8000, stoppad=8000, nodisk=false]

Set genScaffoldInfo=true
Writing chunk 1
Writing chunk 2
Writing chunk 3
Writing chunk 4
Writing chunk 5
Writing chunk 6
Exception in thread "main" java.lang.AssertionError: 714758103, 8000, 7999, 536670912
at dna.FastaToChromArrays2.makeNextChrom(
at dna.FastaToChromArrays2.makeChroms(
at dna.FastaToChromArrays2.main2(
at align2.RefToIndex.makeIndex(
at align2.BBMap.setup(
at align2.AbstractMapper.<init>(
at align2.BBMap.<init>(
at align2.BBMap.main(
I'm pretty sure it's the 'maxlen' argument of dna.FastaToChromArrays2 that is not fit my situation, but I'm not sure how can I fix this.

Did anyone deal with this kinda things before? Any suggestion and discussion is of help! >_<
1989sn1027 is offline   Reply With Quote
Old 10-25-2018, 04:02 AM   #654
Senior Member
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,016

I see that you are assigning 60G of RAM. Have you tried to assign more and see if it helps?
GenoMax is offline   Reply With Quote
Old 10-26-2018, 07:00 AM   #655
Sarah Muller
Junior Member
Location: Brussels

Join Date: Oct 2018
Posts: 1

That's great new. I will download it asap . Thanks for sharing!
I am Sarah, an enthusiastic blondie that has worked as a Brussels escort. These days I am a full-time blogger .
Sarah Muller is offline   Reply With Quote
Old 10-28-2018, 06:51 PM   #656
Junior Member
Location: Shanghai, China

Join Date: Oct 2018
Posts: 3

Originally Posted by GenoMax View Post
I see that you are assigning 60G of RAM. Have you tried to assign more and see if it helps?
Thanks for your replying. In my test I've tried adding java RAM upper limit from 20G all the way to 400G. Yet still the "maxlen" arguments of dna.FastaToChromArrays2 hadn't changed, neighter the error message.
1989sn1027 is offline   Reply With Quote
Old 10-29-2018, 04:57 AM   #657
Senior Member
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,016

@1989sn1027: Brian has not been participating on SA for last few months. You could try to create a ticket at Source Forge and see if he responds to this report.
GenoMax is offline   Reply With Quote
Old 10-29-2018, 06:28 PM   #658
Junior Member
Location: Shanghai, China

Join Date: Oct 2018
Posts: 3

Originally Posted by GenoMax View Post
@1989sn1027: Brian has not been participating on SA for last few months. You could try to create a ticket at Source Forge and see if he responds to this report.
Thanks for your directing. I'll give that a shot.
1989sn1027 is offline   Reply With Quote
Old 12-06-2018, 05:38 AM   #659
Location: USA

Join Date: Oct 2010
Posts: 38

Hi Brain, could you please answer my questions posted here at your convenience?

Thanks in advance.
zeam is offline   Reply With Quote
Old 01-24-2019, 12:36 PM   #660
Junior Member
Location: Providence, RI

Join Date: Jan 2019
Posts: 3
Default Negative Array Size in BBMap


I'm trying to map 16 paired sequences. I've already trimmed the adapters using trimgalore!

Input (scheduled job run on a server):

for i in "${samples[@]}"; do ref=/users/chutfilz/data/chutfilz/Dm3_Index/dm3.fa in="$i"_R1_001_val_1.fa.gz in2="$i"_R2_001_val_2.fa.gz out="$i".sam
Requested 16 cpus, 80g RAM, 24h runtime.


module: loading 'java/8u111'
module: loading 'bbmap/38.23'
module: loading 'samtools/1.9'
java -ea -Xmx47593m -cp /gpfs/runtime/opt/bbmap/38.23/bin/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=/users/chutfilz/data/chutfilz/Dm3_Index/dm3.fa in=PoolCH-1_R1_001_val_1.fa.gz in2=PoolCH-1_R2_001_val_2.fa.gz out=PoolCH-1.sam
Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=/users/chutfilz/data/chutfilz/Dm3_Index/dm3.fa, in=PoolCH-1_R1_001_val_1.fa.gz, in2=PoolCH-1_R2_001_val_2.fa.gz, out=PoolCH-1.sam]
Version 38.24

Retaining first best site only for ambiguous mappings.
Writing reference.
Executing dna.FastaToChromArrays2 [/users/chutfilz/data/chutfilz/Dm3_Index/dm3.fa, 1, writeinthread=false, genscaffoldinfo=true, retain, waitforwriting=false, gz=true, maxlen=536670912, writechroms=true, minscaf=1, midpad=300, startpad=8000, stoppad=8000, nodisk=false]

Set genScaffoldInfo=true
Writing chunk 1
Set genome to 1

Loaded Reference:	0.057 seconds.
Loading index for chunk 1-1, build 1
No index available; generating from reference genome: /gpfs/data/mtatar/chutfilz/trimgalore/ref/index/1/chr1_index_k13_c4_b1.block
Indexing threads started for block 0-1
Indexing threads finished for block 0-1
Generated Index:	15.892 seconds.
Analyzed Index:   	2.851 seconds.
Started output stream:	1.332 seconds.
Cleared Memory:    	0.264 seconds.
Processing reads in paired-ended mode.
Started read stream.
Started 16 mapping threads.
Exception in thread "Thread-28" java.lang.NegativeArraySizeException
	at java.util.Arrays.copyOf(
	at shared.KillSwitch.copyOf(
	at stream.FastaReadInputStream.fillBuffer(
	at stream.FastaReadInputStream.nextHeader(
	at stream.FastaReadInputStream.fillList(
	at stream.FastaReadInputStream.hasMore(
	at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(
	at stream.ConcurrentGenericReadInputStream$
Exception in thread "Thread-27" java.lang.NegativeArraySizeException
	at java.util.Arrays.copyOf(
	at shared.KillSwitch.copyOf(
	at stream.FastaReadInputStream.fillBuffer(
	at stream.FastaReadInputStream.nextHeader(
	at stream.FastaReadInputStream.fillList(
	at stream.FastaReadInputStream.hasMore(
	at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(
	at stream.ConcurrentGenericReadInputStream$
PoolCH-1.sam has begun to write, but it's been five hours (these are Drosophila reads), and no progress on the other 15 paired fasta files.

Where is the negative array???
chutfilz is offline   Reply With Quote

bbmap, metagenomics, rna-seq aligners, short read alignment

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 02:46 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO