Hi All,
I used cutadapt to trim my PE reads and TopHat to map the trimmed ones. TopHat could map most of them. Then I wanted to use HTSeq-Count to count the reads. However it complained like this:
Error occured when processing SAM input (line 184429 of file .../accepted_hits_unique_sorted.sam):
'pair_alignments' needs a sequence of paired-end alignments
[Exception type: ValueError, raised in __init__.py:612]
I checked lines 184429 and 184430 of my input file. Here they are:
DCNW5DQ1:262:C4804ACXX:6:2316:1266:24754 0 14 38508069 50 20M * 0 0 TTAATCTAGAATCCGCATAC ;?F<GHJJIJBHIG0D:6?/ AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:8T11 YT:Z:UUNH:i:1
DCNW5DQ1:262:C4804ACXX:6:2316:1266:24754 153 14 38508069 50 20M * 0 0 TTAATCTAGAATCCGCATAC F=/.=.4F=;?(68*9HDHE AS:i:-4 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:8T11 YT:Z:UUNH:i:1
So they are paired but the flag column of read 1 is 0. This makes no sense. I don't either know if the flag value 153 of read 2 is correct or not.
Also, I've had a similar problem when using Trimmomatic-trimmed PE reads with TopHat. It was also a flag problem but happened in unpaired reads only. Does anybody have any idea?
Thanks,
Sylvia
I used cutadapt to trim my PE reads and TopHat to map the trimmed ones. TopHat could map most of them. Then I wanted to use HTSeq-Count to count the reads. However it complained like this:
Error occured when processing SAM input (line 184429 of file .../accepted_hits_unique_sorted.sam):
'pair_alignments' needs a sequence of paired-end alignments
[Exception type: ValueError, raised in __init__.py:612]
I checked lines 184429 and 184430 of my input file. Here they are:
DCNW5DQ1:262:C4804ACXX:6:2316:1266:24754 0 14 38508069 50 20M * 0 0 TTAATCTAGAATCCGCATAC ;?F<GHJJIJBHIG0D:6?/ AS:i:-6 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:8T11 YT:Z:UUNH:i:1
DCNW5DQ1:262:C4804ACXX:6:2316:1266:24754 153 14 38508069 50 20M * 0 0 TTAATCTAGAATCCGCATAC F=/.=.4F=;?(68*9HDHE AS:i:-4 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:8T11 YT:Z:UUNH:i:1
So they are paired but the flag column of read 1 is 0. This makes no sense. I don't either know if the flag value 153 of read 2 is correct or not.
Also, I've had a similar problem when using Trimmomatic-trimmed PE reads with TopHat. It was also a flag problem but happened in unpaired reads only. Does anybody have any idea?
Thanks,
Sylvia
Comment