SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
removing reads that map to more than one location from gsnap-aligned bam files efoss Bioinformatics 4 07-14-2015 07:39 PM
indexing tophat bam files stormin Bioinformatics 13 12-08-2014 12:38 PM
sam files convert to bam files error awayihaha Bioinformatics 7 03-11-2014 09:03 AM
Problems with Bam files from Tophat bjchen Bioinformatics 0 04-11-2012 12:22 PM
the tophat generate the bam file instead of sam files? dingkai0564 Bioinformatics 1 11-10-2010 07:33 PM

Reply
 
Thread Tools
Old 10-22-2016, 07:38 AM   #1
tfcardoso
Junior Member
 
Location: spain

Join Date: Sep 2016
Posts: 1
Default error in the location of chromosomes (bam files) - ncRNA ref (alignament tophat)

Hello

I made an alignment with ncRNA.fasta sequence by Ensembl using tophat. however... in my output the trancript_ID stay in the chr local... So when I tried to run ht-seq count none sequence is found..

Why does it happen? there is a way to change information for chromosome or be compatible with ht-seq?

please, someone can help me??!!





HWI-7001432L:176:C8DRKANXX:6:2102:9302:3530 pUr1s ENSSSCT00000001325.2 5 1 76M * 0 0 GCCACCGCGGTTCGCGGTTCTAAACTCTCCATCCATTCGCCTCGACTCCGCTTCTCTCCAGACTCCGAGGCTGAGG BGGGGGFGGGGGGGDGDGGEGDGGGGGGGGGEGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCCCCC AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:76 YT:Z:UU NH:i:3 CC:Z:ENSSSCT00000001326.2 CP:i:5 HI:i:0 HWI-7001432L:176:C8DRKANXX:2:1214:8451:68280 353 ENSSSCT00000000705.2 606 1 76M = 788 258 CTAAGTTTTCTTTCTTCTGGTTGGGATTATCATGGGATCCATCTGGCCAAAGGTGGCTGTGGGAAGATGGCACGCT BCCBCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGCGDFGGGGGGGGGGGGGGFGGEGGGGGGGG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:76 YT:Z:UU NH:i:4 CC:Z:ENSSSCT00000033566.1 CP:i:641 HI:i:0
tfcardoso is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:09 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO