SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
GATK: sorting vcf file given a reference file jorge Bioinformatics 4 01-14-2015 12:16 PM
The GATK Best Practices without a dbSNP file? oiiio Bioinformatics 1 11-15-2011 03:24 PM
Conflict between mpileup/bcftools and GATK in VCF file ericarcher Bioinformatics 0 09-25-2011 04:33 PM
Converting Dindel VCF file to GATK BED file MolecularToast Bioinformatics 2 09-24-2011 06:38 PM
GATK: GenomeAnalysisTK.jar file jorge Bioinformatics 2 06-05-2011 08:59 PM

Reply
 
Thread Tools
Old 07-02-2012, 10:51 AM   #1
wangli
Member
 
Location: Texas

Join Date: Apr 2012
Posts: 48
Default GATK sequencing reads file

Dear All

I am trying to use GATK for multiple samples SNP calling. The requirement of input sequence reads file of GATK is 1) .bam 2) indexed 3) coordinate sorted 4) with read group including PL (platform) and SM (sample tags).
I am writing to ask if it is OKAY for me to use the output bam file of tophat as the input file of GATK.
I utilized the samtools to view the output bam file of tophat. The first several lines are as follows:

HS5_204:6:1206:11794:144840 99 scaffold_1 12632 3 19M117N81M = 12775 243 GTCTGTGATGACCAAAGAGGGGAAGTGGCAAATGTCCTTTGTCATGCCATCCAAGTACGGCGCTAATCTGCCTTTGCCCAAGGATCCAACTGTGAGGGTT @<@DBDDDHFDFBHHIIIICBA@8?:C@DADHIE?:?BE*??DFFBGD>D?FDGICF<@;8:9=AB:@CDCC>CCCCCC@BB?5AC?@@CCA:AC@BBB8 AS:i:-9 XM:i:2 XO:i:0 XG:i:0MD:Z:1C43A54 NM:i:2 XS:A:+ NH:i:2 CC:Z:scaffold_16 CP:i:9083845 HI:i:0


Do anyone have idea if i still need to do the index and sort of the bam file with samtools or picard? If so, that would be a lot of work.

Thanks in advance!
Li
wangli is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:22 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO