SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
CIGAR inconsist with read length. Does Bowtie2 reedit read sequence? wisense Bioinformatics 5 05-26-2015 11:35 PM
Miseq FASTQ sequence identifier missing index read? rnaeye Illumina/Solexa 17 05-25-2015 12:21 PM
why the read sequence from IGV can't be found in fastq? hujiacun Bioinformatics 2 04-17-2015 09:24 AM
Convert SRA to FASTQ with fastq-dump but problem of read length MurielGB Illumina/Solexa 9 10-07-2014 09:10 AM
Consensus part from sequence read(fastq) and align(BAM) files culmen Bioinformatics 5 12-21-2010 03:57 AM

Reply
 
Thread Tools
Old 09-26-2018, 09:08 AM   #1
CarnifexRex
Junior Member
 
Location: Dallas

Join Date: Sep 2018
Posts: 4
Default Adaper sequence to Read fastq

Hello,

Fairly new to bioinformatics and first time posting, hopefully I sound halfway intelligent

My FASTQs contain adapter sequences in the read name. This adapter sequence includes a UMI. However my postprocessing software requires the UMI to be part of the read. Is there some way of inserting the adapter sequence from the read name to the beginning of the read? I'm guessing I'll also need to insert some bogus quality scores as well.

To visualize, I need to turn this:
@M01179:478:000000000-C33YY:1:1101:17276:1520 2:N:0:CTTGTATGTATG
TTGTCGTTCCTTTCTTTTTGTCTCTTTCCTGTACCTCTAG
+
[email protected]

into this:

@M01179:478:000000000-C33YY:1:1101:17276:1520 2:N:0:CTTGTATGTATG
CTTGTATGTATGTTGTCGTTCCTTTCTTTTTGTCTCTTTCCTGTACCTCTAG
+
[email protected]

This would need to be a scriptable solution, and work on all reads from a High Out-put NextSeq run

Thanks in advance
CarnifexRex is offline   Reply With Quote
Old 09-26-2018, 11:01 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,795
Default

Are you sure about that? Generally in case of Illumina sequencing index sequences (which are not part of actual reads) are transferred to the fastq header as a part of demultiplexing process. That is what you are probably seeing e.g. "CTTGTATGTATG".
GenoMax is offline   Reply With Quote
Old 09-26-2018, 11:11 AM   #3
CarnifexRex
Junior Member
 
Location: Dallas

Join Date: Sep 2018
Posts: 4
Default

That is correct, sequence CTTGTATGTATG is my index sequence. The first 6 bp (CTTGTA) is my sample barcode, the second 6 bp (TGTATG) is a molecular barcode. This second sequence is random, so changes across every read.

I need to add the entire 12 bp sequence to the beginning of my read in order to utilize the UMI portion of the adapter in my alignment and variant calling software.
CarnifexRex is offline   Reply With Quote
Old 09-27-2018, 04:23 AM   #4
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,795
Default

This may be easier to do by obtaining the index read as a separate fastq file. You will also get real Q-scores for bases in index read when you do that. Stand-alone bcl2fastq allows one to get data in this format. I assume you may be able to do this using BaseSpace as well, if that is what you are using.

You can then use a program called "Seqkit" (and specifically option "seqkit concat" to concatenate your index read in front of the actual read).
GenoMax is offline   Reply With Quote
Old 10-03-2018, 09:19 AM   #5
CarnifexRex
Junior Member
 
Location: Dallas

Join Date: Sep 2018
Posts: 4
Default

Thats fantastic. This confirms by believe that there's a tool for everything.

This does exactly what I need, with one exception. It calls the entire FastQ into memory, which is a problem when the FastQ files are 20GB each.

I thought faidx indexing might help, but 1) bcl2fastq outputs gzip not bgzip files, and 2) my input files are FastQ and not FastA. I also thought of trying to stream the job by just providing a list of read names to concatenate using the seqkit common or grep command, but I couldn't get that to work.

Now I'm thinking of some combination of sort, split and bash loop but I'm still a novice at linux scripting.

Does anyone have some suggestions on how to process large files using seqkit?

Thanks
CarnifexRex is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:51 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO