SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Clip adapter Hisat2 guilhem Bioinformatics 16 02-20-2016 07:18 AM
explanation about hard clip and soft clip reads neha SOLiD 0 06-24-2013 04:26 AM
Clip truseq adapter sequence from fastq uniportdb RNA Sequencing 1 01-29-2013 12:28 AM
Adapter sequences SeqTruth General 2 04-27-2011 07:05 AM
clip 454's adapter? louis7781x 454 Pyrosequencing 4 03-21-2011 05:24 AM

Reply
 
Thread Tools
Old 05-12-2016, 08:56 AM   #1
szy0931
Member
 
Location: us

Join Date: Aug 2015
Posts: 36
Default Questions for Clip adapter sequences

I am analyse my RNA-Seq on Galaxy.
FASTQC results showed me I have overrepresented reads. Many of them are "NNNNNN" and very short reads (<10 bp).
I am using Clip to remove them. (I know clip is for adapter removing and Adapter Content passed FASTQC. But, I cannot find other tools to do this.)

My question is what sequence I should type in the box of "Enter custom clipping sequence" in the Clip tool.

The adapter sequence is "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" from 5' to 3' before index.

Should I put the above whole sequence in the box or I just need to put the first several nucleotides?
szy0931 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:02 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO