SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
trouble getting Bowtie aligner to run alig Bioinformatics 0 07-01-2011 12:08 AM
how to run Bowtie wisosonic Bioinformatics 4 03-17-2011 02:29 AM
Bowtie MD tag format reference mendl7 Bioinformatics 2 02-23-2011 01:47 PM
anyone help me on bowtie format -> sam format! tninja Bioinformatics 2 04-25-2010 09:33 PM
Bowtie output format kevlim83 Bioinformatics 5 01-26-2010 01:28 PM

Reply
 
Thread Tools
Old 02-09-2011, 11:12 AM   #1
zack80.liu
Junior Member
 
Location: TX

Join Date: Feb 2011
Posts: 9
Default What is this format? How to run bowtie on it.

I am a newbie to NGS. Please help.

I have the following file (I was told that it is a export file of illumina)

HWUSI-EAS1744 1 8 1 1165 18707 0 1 CAACAACTCACCTGCCGAACCAACTAGCTCTGACAACCGATGTCAATCGAACATCGGACGCAATGGAGAACAACG BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB NM N
HWUSI-EAS1744 1 8 1 1166 9747 0 1 GGCAAGCCGGATCCGTAACTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGCGCGAAGCGG bbbbbbabbbbbbbbbbbbbbbbbabbbbb`_bbbbbbbbbbbbbbbbbba`bb__bbb[W]`^^BBBBBBBBBB 0:0:1 Y

Q1: How do I convert this to fastaq format?
Q2: Is bbbbbbabbbbbbbbbbbbbbbbbabbbbb`_bbbbbbbbbbbbbbbbbba`bb__bbb[W]`^^BBBBBBBBBB the quality score?
Q3: How to run bowtie on this file.

Thanks.
zack80.liu is offline   Reply With Quote
Old 02-10-2011, 09:33 AM   #2
HSJD19
Junior Member
 
Location: RTP, NC

Join Date: Dec 2010
Posts: 3
Default Format

This is an export file.
HWUSI-EAS1744181116518700 1 - Unique Read Identifier
CAACAACTCACCTGCCGAACCAACTAGCTCTGACAACCGATGTCAATCGAACATCGGACGCAATGGAGAACAACG - Sequence

BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB - Quality Score in Illumina Platform

N - The Y or N in the last column is from the Illumina CHASITY filter. Y means yes it pass N means no . I don't think you should use the N sequences.
HSJD19 is offline   Reply With Quote
Old 02-10-2011, 09:35 AM   #3
HSJD19
Junior Member
 
Location: RTP, NC

Join Date: Dec 2010
Posts: 3
Default

Might I also suggest reading this thread
http://seqanswers.com/forums/showthread.php?t=4589
HSJD19 is offline   Reply With Quote
Old 02-10-2011, 09:50 AM   #4
zack80.liu
Junior Member
 
Location: TX

Join Date: Feb 2011
Posts: 9
Default

Thanks for the reply.
zack80.liu is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:25 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO