SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Strange maq 7.1 problem homeriq5 Bioinformatics 7 11-26-2013 07:19 AM
Cufflinks / Cuffdiff problem Morten Bioinformatics 42 07-13-2013 10:51 PM
Problem with Cufflinks output admiral RNA Sequencing 0 06-01-2011 01:19 PM
strange bowtie index building and mapping problem Gangcai Bioinformatics 0 08-04-2010 05:02 PM
Problem with Tophat and Cufflinks gongchang RNA Sequencing 2 06-08-2010 04:16 PM

Reply
 
Thread Tools
Old 12-02-2010, 09:56 PM   #1
sterding
Member
 
Location: Boston

Join Date: Sep 2010
Posts: 36
Red face strange problem for cufflinks

HI, all

I am facing a strange problem for cufflinks: Reads that are aligned to exons obviously can NOT be counted by cufflinks. Please see if you have the same problem when running the following test.

A simple test SAM file (htt.sam)
Code:
HWUSI-EAS623:1:91:16574:8737#0	16	chr4	3129018	255	40M	*	0	0	AGCTGGCTGCTTCTTCAGGGGTTTCCACTCCAGGGTCAGC	@BBBCE-EEEDGGGDDFGEFGFGAGGGGGEGGGGGGGGDF	NM:i:0	NH:i:1	XS:A:-
HWUSI-EAS623:1:5:14642:7499#0	0	chr4	3129040	255	40M	*	0	0	TTCCACTCCAGGGTCAGCAGGTCATGACATCATCACAGAA	GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFF	NM:i:0	NH:i:1	XS:A:-
HWUSI-EAS623:1:27:15057:20736#0	16	chr4	3129048	255	40M	*	0	0	CAGGGTCAGCAGGTCATGACATCATCACAGAACAGCCACG	EAEEEEEEBEEEGEGEEEBEEEEEEFEGBGGEGFGGGGGG	NM:i:0	NH:i:1	XS:A:-
HWUSI-EAS623:1:117:13132:3189#0	16	chr4	3129072	255	40M	*	0	0	TCACATAACAGCCACGGTCACAGCACACACTGCACGCGGA	@B@CB7EEEEGGGEGGGGGGGGGGGECECECDDD*BBBBB	NM:i:2	NH:i:1	XS:A:-
Here is the GTF file (for test purpose, only transcript ENST00000355072 of gene HTT):
htt_ENST00000355072.gtf

The reads in SAM file are obviously resided in the exonic region of GTF file (see UCSC screenshot)


However, running cufflinks command
Code:
cufflinks --GTF htt_ENST00000355072.gtf htt.sam
will only give 0 FPKM value in the output file (genes.expr):
Code:
$ cat genes.expr 
gene_id	bundle_id	chr	left	right	FPKM	FPKM_conf_lo	FPKM_conf_hi	status
ENSG00000197386	3	chr4	3076406	3245676	0	0	0	OK
I found this problem by double-checking the cufflinks results of a genome-wide RNA-seq analysis; HTT gene has well-aligned reads, but its FPKM is zero. This is not the only case. I am simplifying the problem here by only showing the part of SAM file and GTF file.

Thanks for helps ahead.

Last edited by sterding; 12-02-2010 at 10:03 PM.
sterding is offline   Reply With Quote
Old 12-03-2010, 02:23 AM   #2
plabaj
Member
 
Location: Vienna

Join Date: Oct 2010
Posts: 86
Default

I had somehow similar problem.

I had few thousands reads which fall on specific splice junction belonging to just one transcript.
However, as mentioned above, Cufflinks was blind to them. The FPKM value was suspiciously close to zero for this transcript.

I reported this to Cole Trapnell few weeks ago. So far no response

If somebody know what is the problem I would appreciate such knowledge.
__________________
Pawel Labaj
plabaj is offline   Reply With Quote
Old 12-03-2010, 02:37 AM   #3
Thomas Doktor
Senior Member
 
Location: University of Southern Denmark (SDU), Denmark

Join Date: Apr 2009
Posts: 105
Default

I'm not certain, but I think this is because Cufflinks considers 4 reads in total within a gene as below detection threshold. In cuffdiff, you can adjust this by the "-c" options, but cufflinks doesn't have this, probably because it needs a certain amount of reads to assemble transcripts and doesn't simply count reads within a gene.

Try running Cuffdiff with "-c 2", it should be able to produce an FPKM value then (which will be very close to zero in any case if there is only 4 reads in total). The default -c value is 1000, btw.
Thomas Doktor is offline   Reply With Quote
Old 12-03-2010, 09:44 AM   #4
sterding
Member
 
Location: Boston

Join Date: Sep 2010
Posts: 36
Default

Thanks a lot, Tom

I am re-running cuffdiff using -c option as you suggested, see what FPKM it will get.

meanwhile, I checked the problematic genes; there are reasonable numbers of reads mapped with its exons (see below). Actually the signal is quite clear for me. I wish Tole can open an option for minimal number of reads in cufflinks.

sterding is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:05 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO