SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
featureCounts - order of reads in output file touchsk Bioinformatics 0 11-01-2018 12:12 PM
featureCounts output to DESeq2? lucyf Bioinformatics 0 10-11-2018 03:48 AM
featureCounts error GenoMax Bioinformatics 12 03-28-2017 01:01 AM
featureCounts error heso Bioinformatics 8 11-14-2014 12:14 PM
How to change MapSplice output(txt format) into bed format? kanewong RNA Sequencing 3 04-17-2013 07:57 PM

Reply
 
Thread Tools
Old 02-12-2020, 03:14 AM   #1
slefevre
Junior Member
 
Location: Norway

Join Date: Jun 2015
Posts: 4
Default featureCounts output format error

Hi

I am trying to use the latest version of featureCounts (Subread package version 2.0.0) with the following command (based on Chothani, S. 2019. Current Protocols in Molecular Biology, 129, e108. doi: 10.1002/cpmb.108):

featureCounts -T 5 -t CDS -g gene_id -O -J -R -G /cluster/home/sjannies/blast_databases/GCF_003368295.1_ASM336829v1_genomic.fna -a /cluster/home/sjannies/blast_databases/GCF_003368295.1_ASM336829v1_genomic.gtf -o rfp_mapped_to_goldfish_genome_featureCounts.txt /cluster/work/users/sjannies/rfp/star/bams/24hR50_rfp_goldfish_Aligned.sortedByCoord.out.bam

I get the error: unknown output format: '-G'

If I remove all extra options (-O -J -R -G ) featureCounts finish succesfully.


Anyone have an idea what is wrong?

Cheers
Sjannie

Below is head of gtf file:

#gtf-version 2.2
#!genome-build ASM336829v1
#!genome-build-accession NCBI_Assembly:GCF_003368295.1
#!annotation-source NCBI Carassius auratus Annotation Release 100
NC_039243.1 Gnomon gene 5705 16574 . - . gene_id "LOC113109012"; db_xref "GeneID:113109012"; gbkey "Gene"; gene "LOC113109012"; gene_biotype "protein_coding";
NC_039243.1 Gnomon exon 16363 16574 . - . gene_id "LOC113109012"; transcript_id "XM_026272525.1"; db_xref "GeneID:113109012"; gbkey "mRNA"; gene "LOC113109012"; model_evidence "Supporting evidence includes similarity to: 8 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 74 samples with support for all annotated introns"; product "OX-2 membrane glycoprotein-like, transcript variant X1"; exon_number "1";


Output of command 'grep "CDS" /cluster/home/sjannies/blast_databases/GCF_003368295.1_ASM336829v1_genomic.gtf | head':

NC_039243.1 Gnomon CDS 16363 16512 . - 0 gene_id "LOC113109012"; transcript_id "XM_026272525.1"; db_xref "GeneID:113109012"; gbkey "CDS"; gene "LOC113109012"; product "OX-2 membrane glycoprotein-like isoform X1"; protein_id "XP_026128310.1"; exon_number "1";
NC_039243.1 Gnomon CDS 15265 15340 . - 0 gene_id "LOC113109012"; transcript_id "XM_026272525.1"; db_xref "GeneID:113109012"; gbkey "CDS"; gene "LOC113109012"; product "OX-2 membrane glycoprotein-like isoform X1"; protein_id "XP_026128310.1"; exon_number "2";


Following is head of bam file:
NB501273:265:HVMKCBGXC:3:22503:25876:14641 16 NC_039243.1 1360 255 16M1D14M * 0 0 TTAGATAAAACTTCTGCGCTTAACAGATCT EEAE/A/A//EEEEEEE6AEEEE/EAA/66 NH:i:1 HI:i:1 AS:i:25 nM:i:0 NM:i:1 MD:Z:16^C14 jM:B:c,-1 jI:B:i,-1
NB501273:265:HVMKCBGXC:3:21606:21604:16716 272 NC_039243.1 6218 1 30M * 0 0 CTTCAGGCAGATACACAGACATACGAGCAG EEEEEEEEEEEEEEEEEEEEEEEEEAAAAA NH:i:4 HI:i:2 AS:i:29 nM:i:0 NM:i:0 MD:Z:30 jM:B:c,-1 jI:B:i,-1
slefevre is offline   Reply With Quote
Reply

Tags
featurecounts, subread

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:47 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO