
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
cufflinks: input alignment from hisat2 dovah RNA Sequencing 5 05-09-2018 01:09 AM
XS tags in hisat2 alignment dovah Bioinformatics 4 08-07-2016 02:00 AM
BOWTIE2: How to randomly map a read to single alignment when read is multimapping? cbaudo Bioinformatics 5 01-27-2016 09:33 AM
Tophat-accepted_hits.bam file shows more read with samtools flagstat mehtaaditya RNA Sequencing 15 09-22-2015 10:37 AM

Thread Tools
Old 07-18-2018, 01:02 PM   #1
Junior Member
Location: CA, USA

Join Date: Oct 2011
Posts: 5
Default HISAT2: a surprising read shows up in alignment results

I was spot-checking the output of alignment results from HISAT2 and noticed one read (CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT shown below) that does not exist in my input fastq files. Is this the result of a bug or am I missing anything?

$ hisat2 -p 40 -x hg19/genome -1 read1.fq.gz -2 read2.fq.gz 2>/dev/null | grep CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT
$ hisat2 -p 40 -x hg19/genome -1 read1.fq.gz -2 read2.fq.gz 2>/dev/null | grep HISEQ:287:CCK1AANXX:5:2307:14574:99798

The other two entries in the sam output with read name of HISEQ:287:CCK1AANXX:5:2307:14574:99798 are from my input fastq files as expected (a read pair).

I appreciate any comments. Thanks!
yip is offline   Reply With Quote
Old 07-18-2018, 04:58 PM   #2
Junior Member
Location: CA, USA

Join Date: Oct 2011
Posts: 5

Here's the answer (thanks to Daehwan from the HISAT2 team):
yip is offline   Reply With Quote


Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 12:48 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO