SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
PubMed: Saliva samples are a viable alternative to blood samples as a source of DNA f Newsbot! Literature Watch 0 03-07-2013 12:20 AM
[help]what's wrong with multiplexed sequencing uattsoancrik Illumina/Solexa 16 04-07-2012 05:07 PM
Read number variation in pooled/multiplexed samples -- any tips? gringer Illumina/Solexa 2 01-06-2012 11:18 AM
Alignment of multiplexed fragment samples (SOLiD) NGS-Jo Bioinformatics 0 01-25-2011 01:36 AM
Mutation discovery by targeted genomic enrichment of multiplexed barcoded samples Asashoryu Literature Watch 0 11-04-2010 12:55 PM

Reply
 
Thread Tools
Old 02-18-2015, 06:51 AM   #1
cbaudo
Member
 
Location: Missouri

Join Date: Jan 2013
Posts: 21
Default Trimmomatic and Multiplexed Samples

Hello and thanks for reading,

I'm performing adapter trimming for the first time using Trimmomatic on paired-end reads. We solicited a third party to generate our RNA-seq libraries and they used the TruSeq® v1/v2/LT Sample Prep Kits. The TruSeq Universal Adapter is
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
which corresponds to the TruSeq2-PE.fa fasta file in the adapter folder. Should I select this fasta file or should I use the adapter sequence for each indexed sample? For example, they have returned my fastq files with my samples and the index used.

Sample1_CCGTCC_L002_R1_001.fastq.gz
Sample2_CCGTCC_L002_R2_001.fastq.gz

Should I use the TruSeq Adapter for the corresponding index to trim?
TruSeq Adapter, Index 16
5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTG

I have 21 samples that were multiplexed on a single lane.

Additionally, is trimming prior to alignment necessary? Apologies if this is confusing and thank you for your time.
cbaudo is offline   Reply With Quote
Old 02-18-2015, 07:31 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,888
Default

Scanning your sequence files with a trimming program is always a good idea. If you do not have adapter contamination then all reads should pass through intact. You want to remove any extraneous sequence from your reads since this could cause problems downstream.

You can use the file provided with trimmomatic TruSeq2-PE.fa [EDIT: See post #3]. That covers the common part of the TruSeq adapters.

Last edited by GenoMax; 02-19-2015 at 08:42 AM. Reason: correction
GenoMax is offline   Reply With Quote
Old 02-19-2015, 08:32 AM   #3
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,156
Default

Quote:
Originally Posted by GenoMax View Post
You can use the file provided with trimmomatic TruSeq2-PE.fa. That covers the common part of the TruSeq adapters.
Use the TruSeq3-PE.fa file, not the TruSeq2-PE.fa file. The file names in Trimmomatic do not correspond to Illumina kit numbers.

The TruSeq2 file corresponds to very early kits and does not account for indexed adapters. TruSeq3-PE.fa (or TruSeq3-PE-2.fa in the very latest releases of Trimmomatic) is the file you want for any libraries constructed with TruSeq v2 and later.
kmcarr is offline   Reply With Quote
Old 02-19-2015, 10:59 AM   #4
cbaudo
Member
 
Location: Missouri

Join Date: Jan 2013
Posts: 21
Default

GenoMax and kmcarr,

Thank you both for your responses. They have been extremely helpful.
cbaudo is offline   Reply With Quote
Old 02-19-2015, 11:01 AM   #5
cbaudo
Member
 
Location: Missouri

Join Date: Jan 2013
Posts: 21
Default

kmcarr,

What are the differences between TruSeq3-PE.fa and TruSeq3-PE-2.fa? I've downloaded the latest release of Trimmomatic and have access to the PE-2 fasta file.

Thanks.
cbaudo is offline   Reply With Quote
Old 02-20-2015, 06:54 AM   #6
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,156
Default

Quote:
Originally Posted by cbaudo View Post
kmcarr,

What are the differences between TruSeq3-PE.fa and TruSeq3-PE-2.fa? I've downloaded the latest release of Trimmomatic and have access to the PE-2 fasta file.

Thanks.
Near as I can tell in the '-2' file they have added the same sequences (plus their reverse complements) but using names other than the "PrefixPE/[12]" format. Naming the adapters with the PrefixPE/1 and PrefixPE/2 format is required for Trimmomatic's palindrome trimming mode. My guess (and it's just a guess) is that they added the additional representations of the same adapters so you can use one file for both palindrome trimming mode and more conventional trimming.
kmcarr is offline   Reply With Quote
Reply

Tags
adapter trimming, trimmomatic

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:07 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO