SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > SOLiD



Similar Threads
Thread Thread Starter Forum Replies Last Post
SR Adapters on a PE flowcell? andibody Illumina/Solexa 15 09-17-2014 05:38 AM
Adapters sequence Chartiza Ion Torrent 7 02-01-2012 08:01 AM
Custom SOLID Adapters for RNA-Seq nbogard SOLiD 2 12-01-2011 06:19 PM
expiration adapters odile Illumina/Solexa 11 11-21-2011 09:28 AM
adapters avatar10 General 2 12-02-2010 05:04 AM

Reply
 
Thread Tools
Old 09-22-2008, 08:10 AM   #1
exprofiler
Junior Member
 
Location: Germany

Join Date: Sep 2008
Posts: 2
Default SOLiD Adapters

Hello,
I would like to sequence gene expression tags with the SOliD machine-does anybody have the adapter-sequences flanking the inserts or do you know where could I get them?
Also, is there a relaible service provider for the SOliD system out there ?
Thank you very much in advance!
exprofiler is offline   Reply With Quote
Old 09-28-2008, 12:12 PM   #2
universalprimer
Junior Member
 
Location: US

Join Date: Sep 2008
Posts: 1
Default

Here are the sequences for most of the current solid oligos, I tried to display it like the post in the solexa forum. I don't know the sequences of the P1 primer on the bead, the actual sequencing primers, or all the "block" oligos.

SOLiD 2.0 Oligos

P1 Adapter:
5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (-) -------------------- -------------------- - 3'
3' ---------------TTGG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (-) -------------------- -------------------- - 5'

P2 Adapter:
5' -------------------- -------------------- ------------------ (-) AGAGAATGAGGAACCCGGGG CAGTT--------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'

Library PCR Primer1:
5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATG------------- (-) -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 5'

Library PCR Primer2:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'

Resulting Frag Library:
5' -----------------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT (N) AGAGAATGAGGAACCCGGGG CAG----------------- - 3'
3' -----------------GG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA (N) TCTCTTACTCCTTGGGCCCC GTC----------------- - 5'


Mate pair oligos

EcoP15I Cap Adapter (note AC 3' overhang on one end)
5' -------pCTGCTGTAC---------- - 3'
3' --------GACGACAp----------- - 5'

Internal Adapter (note: lowercase T in top strand has internal biotin, note GT 3' overhangs for sticky end circularization)
5' --------CGTACAtCCGCCTTGGCCGT----- - 3'
3' ------TGGCATGTAGGCGGAACCGG------- - 5'

Last edited by universalprimer; 09-28-2008 at 12:29 PM.
universalprimer is offline   Reply With Quote
Old 09-29-2008, 04:25 AM   #3
exprofiler
Junior Member
 
Location: Germany

Join Date: Sep 2008
Posts: 2
Thumbs up

thank you !!
exprofiler is offline   Reply With Quote
Old 10-02-2008, 02:31 PM   #4
snetmcom
Senior Member
 
Location: USA

Join Date: Oct 2008
Posts: 156
Default

there are a few service providers out there. Your best bet would be to contact ABI. Seqwright and Agencourt are the two big ones, but I wouldnt send my samples anywhere other than agencourt.
snetmcom is offline   Reply With Quote
Old 10-30-2008, 11:26 AM   #5
atp
Junior Member
 
Location: de

Join Date: Sep 2008
Posts: 3
Default

Does anybody know the sequence of the multiplexing adapters (barcoding) for the SOLiD system?
atp is offline   Reply With Quote
Old 10-30-2008, 02:13 PM   #6
Chipper
Senior Member
 
Location: Sweden

Join Date: Mar 2008
Posts: 324
Default

Yes, but you should contact ABI since it is not officaly released yet...
Chipper is offline   Reply With Quote
Old 03-13-2010, 10:33 AM   #7
mulligan
Junior Member
 
Location: Boston

Join Date: May 2009
Posts: 2
Default Y-Based SOLiD Adaptors

Has anyone heard if AB was planning on switching to Y-based adaptors and A- tailing for fragment libraries?
mulligan is offline   Reply With Quote
Old 03-16-2010, 04:23 AM   #8
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,308
Default

Quote:
Originally Posted by mulligan View Post
Has anyone heard if AB was planning on switching to Y-based adaptors and A- tailing for fragment libraries?
I have not heard anything along those lines. Seems like there would be a down side to y-adaptors. They would introduce some self-complementarity into the amplicons that could make the template strands less available for replication. And if you plan on doing any pre-ePCR PCR at all, they are unnecessary because the PCR "suppression effect" drastically favors amplification of amplicons not flanked by the same adaptor type.

--
Phillip
pmiguel is offline   Reply With Quote
Old 03-18-2010, 06:09 AM   #9
AdrianCarr
Junior Member
 
Location: Cambridge, UK

Join Date: Jun 2009
Posts: 1
Default

Does anyone know the sequence of the 'LMP CAP Adapter' used in the long mate-paired protocol? I assume it is similar to the EcoP15I Cap Adapter...

Thanks

Adrian
AdrianCarr is offline   Reply With Quote
Old 03-19-2010, 09:10 AM   #10
Nitrogen-DNE-sulfer
Member
 
Location: In CPT code hell

Join Date: Aug 2009
Posts: 20
Default

I saw a slide at AGBT which suggested AB is making sequencing primers to allow customers to sequence their ILMN libraries on SOLiD. These would leverage the Y adaptors.
Speaking to the Invitrogen people, TA cloning is much more efficient than blunt cloning and can be leveraged with either approach. If you look at oligos above you can remove one A from them (near the N) and get them to be compliant with TA cloning. You probably need to tweak the adaptor to insert ratio to reduce dimers as blunt requires a lot more adaptor.
Also need to alter the end repair reaction to ensure PlusA. The Sequencing primers should be unaffected as the Plus A is just replicating the 3'A on the oligo so the end molecules is the same.

We've also seen the use of thioates on the TT overhangs to help. We see the adaptors over time or with different oligo lots have a different propensity to form dimers. We attribute this to the TT tails being hydrolyzed or exo'd and thus the dimer which forms is 60-70bp. The only way this dimer size makes sense is if there is tail to tail dimerization which then dimerizes again.
would love to know if anyone has sanger sequenced these to confirm what the dimers are as the size after PCR doesnt make sense unless more than 2 molecules are coming together.

I think the biggest pick up is in A-Tailing. The Y-adaptors on paper should help get 2 X more as every strand gets P1 and P2 where as the AB method is a punnett square with P1-P1 and P2-P2 molecules being formed but presumably not amplifying so 50% of the inserts are wasted. The reason I say on paper is I have heard the Y-adaptors have some suppression PCR effects as well and havent seen a direct comparison of the yield between the methods.
Nitrogen-DNE-sulfer is offline   Reply With Quote
Old 03-19-2010, 10:25 AM   #11
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,308
Default

Quote:
Originally Posted by Nitrogen-DNE-sulfer View Post
I think the biggest pick up is in A-Tailing. The Y-adaptors on paper should help get 2 X more as every strand gets P1 and P2 where as the AB method is a punnett square with P1-P1 and P2-P2 molecules being formed but presumably not amplifying so 50% of the inserts are wasted. The reason I say on paper is I have heard the Y-adaptors have some suppression PCR effects as well and havent seen a direct comparison of the yield between the methods.
2x seems like a lot--but is it? As we have discussed before, these protocols are so inefficient that they often have you start with a million-fold more sample molecules than actually end up making it through the full procedure. (With Illumina and SOLiD protocol it is hard to even estimate what the final molecular yield is, because they generally will entail at least some PCR amplification along the way.)

Are blunt end ligations really less efficient than single base 3' complementary base overhangs? Historically the T-tailed cloning vectors seemed to become popular as quick ways to clone PCR products. But this was because Taq polymerase added a non-templated 3' A base. And Taq is the very devil to get rid of (being thermostable and all) sufficiently that polishing enzymes could remove the base without the A just getting added back again. Basically you could row upsteam or downstream with your protocol.

--
Phillip
pmiguel is offline   Reply With Quote
Old 07-01-2010, 05:42 AM   #12
volks
Member
 
Location: hd.de

Join Date: Jun 2010
Posts: 81
Default

Quote:
Originally Posted by AdrianCarr View Post
Does anyone know the sequence of the 'LMP CAP Adapter' used in the long mate-paired protocol? I assume it is similar to the EcoP15I Cap Adapter...
I would also be interested. Also, does someone know which part is required for ligation primer hybridization (or the sequence of the ligation primer)?
volks is offline   Reply With Quote
Old 07-01-2010, 10:27 AM   #13
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,308
Default

Quote:
Originally Posted by volks View Post
I would also be interested. Also, does someone know which part is required for ligation primer hybridization (or the sequence of the ligation primer)?
The internal and cap adaptor sequences were posted up thread:

http://seqanswers.com/forums/showpos...81&postcount=2


The internal adaptor+ CAP Adaptors ligate into:

5'-CTGCTGTACCGTACATCCGCCTTGGCCGTACAGCAG-3'

The 3' terminus, or there about, would be your ligation primer. I'm not sure the exact length.

--
Phillip
pmiguel is offline   Reply With Quote
Old 07-01-2010, 11:10 PM   #14
volks
Member
 
Location: hd.de

Join Date: Jun 2010
Posts: 81
Default

The question was whether the 'EcoP15I Cap Adapter' and the 'LMP CAP Adapter' are the same. So far I couldn't find the 'LMP CAP Adapter' sequence.
volks is offline   Reply With Quote
Old 07-02-2010, 03:14 AM   #15
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,308
Default

Quote:
Originally Posted by volks View Post
The question was whether the 'EcoP15I Cap Adapter' and the 'LMP CAP Adapter' are the same. So far I couldn't find the 'LMP CAP Adapter' sequence.
They have the same sequence. They differ only in the 5' phosphorylation state of the shorter oligo. This is from p. 206 of the SOLiD 4 System Library Preparation Guide:

EcoP15I CAP Adaptor, 50 µM
5′ Phos-CTGCTGTAC-3′
5′ Phos-ACAGCAG-3′

LMP CAP Adaptor, 50 µM
5′ Phos-CTGCTGTAC-3′
5′ -ACAGCAG-3′

--
Phillip
pmiguel is offline   Reply With Quote
Old 08-18-2010, 02:20 AM   #16
KevinLam
Senior Member
 
Location: SEA

Join Date: Nov 2009
Posts: 197
Default

Is there an official download source for the updated SOLiD adaptor sequences?
The one I am using is from the bioscope example dataset
./applications/wholeTranscriptome.run/.run/reads/human_filter_reference.fasta

looking at this list I think that file which I had previously thought sufficient seems to be quite lacking!
other than the human tRNAs and line repeats,
it lists the 16 barcodes
>adaptor + bc16 + P2
and only
>P1 adaptor.
KevinLam is offline   Reply With Quote
Old 11-30-2010, 12:49 AM   #17
yksikaksi
Member
 
Location: Scandinavia

Join Date: Dec 2009
Posts: 20
Default

You can refer to this appendix D (page 206 onwards) of Applied Biosystems SOLiD™ 4 System Library Preparation Guide which covers:
1. Library construction oligonucleotides
2. Adaptor sequences
3. Multiplex adaptor and barcode sequences
yksikaksi is offline   Reply With Quote
Old 01-03-2011, 06:15 AM   #18
harrike
Member
 
Location: St. Louis, MO

Join Date: Jun 2010
Posts: 29
Default

Quote:
Originally Posted by yksikaksi View Post
You can refer to this appendix D (page 206 onwards) of Applied Biosystems SOLiD™ 4 System Library Preparation Guide which covers:
1. Library construction oligonucleotides
2. Adaptor sequences
3. Multiplex adaptor and barcode sequences
Thank you very much. That's exactly what i want.
harrike is offline   Reply With Quote
Old 05-05-2011, 07:57 AM   #19
aushev
Member
 
Location: Europe

Join Date: Nov 2009
Posts: 18
Default

What about adaptors used for RNA ligation in "Total RNA-Seq" kit? if I am not wrong, their sequenced are not disclosed here?
Thanks in advance.
aushev is offline   Reply With Quote
Old 05-05-2011, 10:24 AM   #20
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,308
Default

Yeah, Ambion is playing that pretty close to their vest.

Unfortunate because with the recent major drop in the cost of both Illumina library construction kits and vast increase in the amount of sequence produced per run, I fear the SOLiD may no longer be competitive for RNA seq.

Reagent costs for the SOLiD RNA sequence library construction kit needs to drop down to around $50/sample. The Illumina kit is around $70/sample -- but that includes polyA isolation!

--
Phillip
pmiguel is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:02 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO