SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > SOLiD



Similar Threads
Thread Thread Starter Forum Replies Last Post
SR Adapters on a PE flowcell? andibody Illumina/Solexa 15 09-17-2014 05:38 AM
Adapters sequence Chartiza Ion Torrent 7 02-01-2012 08:01 AM
Custom SOLID Adapters for RNA-Seq nbogard SOLiD 2 12-01-2011 06:19 PM
expiration adapters odile Illumina/Solexa 11 11-21-2011 09:28 AM
adapters avatar10 General 2 12-02-2010 05:04 AM

Reply
 
Thread Tools
Old 05-05-2011, 10:43 AM   #21
aushev
Member
 
Location: Europe

Join Date: Nov 2009
Posts: 18
Default

well, for the moment I am working with microRNA, i.e. don't care about polyA.
(to tell the full story, I am trying to understand if there is a way to make miRNA->cDNA library compatible for both sequencing and qPCR - that's why my question about adapters arose)
aushev is offline   Reply With Quote
Old 05-05-2011, 02:06 PM   #22
aushev
Member
 
Location: Europe

Join Date: Nov 2009
Posts: 18
Default

ok, finally I found by myself
according to published patent 20100279305, adaptor oligo mix contains
1) 5'-CCUCUCUAUGGGCAGUCGGUGAU (3.1 μM)
2) 5'-NNNNNNATCACCGACTGCCCATAGAGAGG (6.1 μM)
3) 5'-PO4--CGCCTTGGCCGTACAGCAG (3.1 μM)
4) 5'-CTGCTGTACGGCCAAGGCGNNNNNN (6.1 μM)
aushev is offline   Reply With Quote
Old 05-05-2011, 02:28 PM   #23
aushev
Member
 
Location: Europe

Join Date: Nov 2009
Posts: 18
Default

And this is how they can be aligned to known P1 and internal adapters mentioned in post #2:

P1 Adapter:
1) 5' -------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT
2) 3' -----TTGG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA NNNNNN

Internal Adapter
3) 5' --------CGTACAtCCGCCTTGGCCGTACAGCAG
4) 3' ------TGGCNNNNNNGCGGAACCGGCATGTCGTC
aushev is offline   Reply With Quote
Old 05-05-2011, 05:04 PM   #24
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,357
Default

Quote:
Originally Posted by aushev View Post
ok, finally I found by myself
according to published patent [snip]
While patents are a great place to look, I'd caution you that even though it's listed there doesn't mean that's what is in your current kit...!
ECO is offline   Reply With Quote
Old 05-05-2011, 08:02 PM   #25
aushev
Member
 
Location: Europe

Join Date: Nov 2009
Posts: 18
Default

Quote:
Originally Posted by ECO View Post
While patents are a great place to look, I'd caution you that even though it's listed there doesn't mean that's what is in your current kit...!
thanks for cautioning, I totally agree, that's why I indicated the source of data.
aushev is offline   Reply With Quote
Old 05-06-2011, 03:46 AM   #26
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,309
Default

Quote:
Originally Posted by aushev View Post
[...]



4) 3' ------TGGCNNNNNNGCGGAACCGGCATGTCGTC
Where does the 3' terminal "TGGC" come from?

--
Phillip
pmiguel is offline   Reply With Quote
Old 05-06-2011, 03:56 AM   #27
aushev
Member
 
Location: Europe

Join Date: Nov 2009
Posts: 18
Default

Quote:
Originally Posted by pmiguel View Post
Where does the 3' terminal "TGGC" come from?
Phillip
Sorry, I didn't make it clear - I meant that TGGC is only in internal adapter, not in this one. Adaptors from the ligation mix are marked in red/magenta.
aushev is offline   Reply With Quote
Old 05-06-2011, 05:13 AM   #28
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,309
Default

Quote:
Originally Posted by aushev View Post
Sorry, I didn't make it clear - I meant that TGGC is only in internal adapter, not in this one. Adaptors from the ligation mix are marked in red/magenta.
Ah, I get it now.

Thanks for your post. I got the extensive patent documentation. I have not carefully read it, but it looks very interesting. ECO had mentioned elsewhere how useful these could be, but I'd never checked for myself.

I am not understanding the motivations for companies to be so secretive about information disclosed publicly in their patent applications. What is up with that?

--
Phillip
pmiguel is offline   Reply With Quote
Old 06-07-2012, 02:12 AM   #29
koala
Junior Member
 
Location: Italy

Join Date: Jan 2012
Posts: 7
Default

I'm not sure to understand ... the IA you're speaking about..is the IA given from the hybridization of MPL and MPR adaptors? because I've tried to sequence the IA by Sanger technologies and what I found is that I can read correctly the first bases and the lasts, but in the middle the sequence is a "double-seq"!!

THANKS chiara
koala is offline   Reply With Quote
Old 06-07-2012, 04:09 AM   #30
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,309
Default

Quote:
Originally Posted by koala View Post
I'm not sure to understand ... the IA you're speaking about..is the IA given from the hybridization of MPL and MPR adaptors? because I've tried to sequence the IA by Sanger technologies and what I found is that I can read correctly the first bases and the lasts, but in the middle the sequence is a "double-seq"!!

THANKS chiara
The IA (Internal Adapter) is a "center adapter" in SOLiD mate-pair library construction--the one that attaches the two ends of the large DNA fragment into a circle. I don't want to descend into the depths of mate-pair library construction here, but you end up with:

adapter P1-insert1-IA-insert2-adapter P2

, where the inserts are either end of the same long DNA fragment. You prime one read from inside IA, and the other from P1.

For their bar coding strategy for fragment libraries, ABI decided to re-purpose the mate-pair structure:

adapter P1-insert-IA-BC-adapter P2

Then you get your bar code read from the IA-primed read.

I think you are right, in the most recent iteration of ABI's mate pair library construction kit, the IA would be formed by the hybridization of MPL and MPR. They used to just have a double-stranded internal adapter that allowed circularization via a ligation.

--
Phillip
pmiguel is offline   Reply With Quote
Old 06-08-2012, 12:17 AM   #31
koala
Junior Member
 
Location: Italy

Join Date: Jan 2012
Posts: 7
Default

Dear Phillip,
I'm quite conscious on the SOLiD mate pair library, the steps and the structure of the mate (p1-insert-mpl-mpr-insert-p2) .. it's about one year I'm trying to improve the robustness of the method. Belong to my experience the protocol of the mp isn't satisfactory and mainly replicable.

SO, I'm trying to find other way to overcame some steps that in my opinion are limiting. The circularization is one of these points. The problem to circularize DNA is that the IA (in the 5500 xl is formed by mpr and mpl) contains part of the ligation site for the annealing in sequencing. Therefore, the importance of knowing the IA sequence ( and it is irreplaceable).

I was interested in that post, because you (or someone else) wrote the IA sequence with a string of NNNNN. I thought that my sanger sequence on the IA was with a double signal (2 picks) because of the NNNNN string.
I'm not sure if it's more clear my question on the Mpl Mpr sequence!

thanks for your answers

chiara
koala is offline   Reply With Quote
Old 06-08-2012, 04:21 AM   #32
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,309
Default

Hi chiara,
I do not think there should be any NNNNN in SOLiD mate pair adapters. But you would need to explain what you mean by:

Quote:
I've tried to sequence the IA by Sanger technologies
What exactly did you sequence? That is what did you prime your sequencing reaction with and what were your results?

--
Phillip
pmiguel is offline   Reply With Quote
Old 06-16-2012, 07:36 AM   #33
peggywangping
Junior Member
 
Location: singapore

Join Date: Jun 2012
Posts: 3
Default

Oo , I am also curious about the MPL and MPR adaptor, esp it contains a "mysterious" blocking oligo during the circulization step according to the protocol, is there anybody can tell me their "tricks"???


thanks a lot!
peggywangping is offline   Reply With Quote
Old 06-19-2012, 03:38 AM   #34
dongyongdong
Junior Member
 
Location: shenzhen

Join Date: Aug 2011
Posts: 4
Default

hello yksikaksi, I noticed you knew many about the SOLiD, so I think maybe you can help me out of my problem: do you know the sequence of the sequencing primer complemented with the P1 adapter, I want to know which of the chains in the dsDNA was binded to the beads, if you know this, could you please reply as soon as possible, thank you very much.
__________________
Nothing is impossible!
dongyongdong is offline   Reply With Quote
Old 06-19-2012, 05:07 AM   #35
yksikaksi
Member
 
Location: Scandinavia

Join Date: Dec 2009
Posts: 20
Default

Quote:
Originally Posted by dongyongdong View Post
hello yksikaksi, I noticed you knew many about the SOLiD, so I think maybe you can help me out of my problem: do you know the sequence of the sequencing primer complemented with the P1 adapter, I want to know which of the chains in the dsDNA was binded to the beads, if you know this, could you please reply as soon as possible, thank you very much.
Dear dongyongdong,

Perhaps you could have a look on this post of this thread.
yksikaksi is offline   Reply With Quote
Old 06-19-2012, 09:07 PM   #36
dongyongdong
Junior Member
 
Location: shenzhen

Join Date: Aug 2011
Posts: 4
Default

Dear yksikaksi,
thanks for your quick reply, and I finally make myself clear about this queation, the P1adapter is fixed on the beads, so the sequence of the 5'-end of the P1 was what I want. Thanks again. best regards.
__________________
Nothing is impossible!
dongyongdong is offline   Reply With Quote
Old 10-30-2012, 11:04 PM   #37
ringo1230
Junior Member
 
Location: japan

Join Date: Aug 2012
Posts: 2
Default

Please tell me the sequence of the adapter of MPL and MPR of Mate-Paired.
I would also like to have a biotin position.
I want to ligate another adapter to blunt-end after ligation the MP adapter.
I'm worried biotin will drop from the adapter by blunt-end.

thanks
ringo1230 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:44 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO