TrainGlimmerHMM error 28 Incorrect order for exon coordinates

[angel-sakura]

I try to use trainGlimmerHMM to train my data, I got this error : ERROR 28: Incorrect order for exon coordinates: gene scaffold104. Bad line: scaffold104 20180913 20180770

So I checked this genes coordinates (list below), and couldn't find any wrong:
scaffold104 20174822 20173995
scaffold104 20180913 20180770
scaffold104 20183506 20183397
scaffold104 20184035 20183599
scaffold104 20188275 20188173
scaffold104 20190983 20190835
scaffold104 20191959 20191897
scaffold104 20194303 20194184
scaffold104 20197104 20196972
scaffold104 20198118 20198003
scaffold104 20217496 20217292
scaffold104 20221755 20221627
scaffold104 20228524 20228383
scaffold104 20238530 20238461
scaffold104 20239760 20239596
scaffold104 20243877 20243754
scaffold104 20249167 20249095
scaffold104 20249658 20249551
scaffold104 20260983 20260867
scaffold104 20261895 20261756
scaffold104 20267526 20267477
scaffold104 20272089 20272008
scaffold104 20289554 20289440
scaffold104 20291318 20291164
scaffold104 20298180 20298032
scaffold104 20305261 20305165
scaffold104 20308792 20308673
scaffold104 20317857 20317717
scaffold104 20324247 20324165
scaffold104 20326271 20326145
scaffold104 20327459 20327360
scaffold104 20327666 20327577
scaffold104 20335394 20335188
scaffold104 20341344 20341216
scaffold104 20404252 20404189

Could someone please tell me what is wrong with it and how to fix it?

Thank you very much!

[holmrenser]

Are you sure that you have a single gene that spans >300Kb? Otherwise you have to include newlines in between genes.

This is directly from the glimmer manual http://ccb.jhu.edu/software/glimmerh...html#training?:

III.3 Training GlimmerHMM
To train GlimmerM you should run trainGlimmerM with the following command:

trainGlimmerHMM <mfasta_file> <exon_file> [optional_parameters]

<mfasta_file> and <exon_file> are the multi-FASTA file and the file containing the exon coordinates of the known genes, respectively.
<mfasta_file> is a multifasta file containing the sequences for training with the usual format:

>seq1
AGTCGTCGCTAGCTAGCTAGCATCGAGTCTTTTCGATCGAGGACTAGACTT
CTAGCTAGCTAGCATAGCATACGAGCATATCGGTCATGAGACTGATTGGGC
>seq2
TTTAGCTAGCTAGCATAGCATACGAGCATATCGGTAGACTGATTGGGTTTA
TGCGTTA

<exon_file> is a file with the exon coordinates relative to the sequences contained in the <mfasta_file>; different genes are separated by a blank line; I am assuming a format like below:

seq1 5 15
seq1 20 34

seq1 50 48
seq1 45 36

seq2 17 20

In this example seq1 has two genes: one on the direct strand and another one on the complementary strand. Here you can find a real example of fasta and exon files.

[angel-sakura]

Are you sure that you have a single gene that spans >300Kb? Otherwise you have to include newlines in between genes.

This is directly from the glimmer manual http://ccb.jhu.edu/software/glimmerh...html#training?:

Thank you very much for your reply.
Yes, it's a long gene. But even if I use some genes with normal size, I still get this error. I could give you another example:

ERROR 28: Incorrect order for exon coordinates: gene scaffold110. Bad line: scaffold110 11235373 11235248

The gene coordinate is below:
scaffold110 11235103 11232923
scaffold110 11235373 11235248
scaffold110 11238367 11238215
scaffold110 11241399 11241185
scaffold110 11245142 11245006
scaffold110 11247079 11246901
scaffold110 11248130 11248013
scaffold110 11251714 11251604
scaffold110 11252262 11252142
scaffold110 11254761 11254594
scaffold110 11256826 11256760

Thank you