SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics
Similar Threads
Thread Thread Starter Forum Replies Last Post
Odd behavior using samtools mpileup, bcftools JimC Bioinformatics 7 05-21-2013 11:34 AM
samtools mpileup and bcftools not reporting dbSNP ids dmb Bioinformatics 2 08-13-2012 10:18 PM
Samtools mpileup/bcftools cristae8 Bioinformatics 3 05-02-2012 12:43 PM
samtools mpileup and bcftools command lines to compare individual differences? aslihan Bioinformatics 1 11-17-2011 02:20 PM
samtools mpileup questions go2seq Genomic Resequencing 1 09-05-2011 07:09 PM

Reply
 
Thread Tools
Old 07-26-2011, 04:21 AM   #1
chenjy
Member
 
Location: China

Join Date: Oct 2010
Posts: 22
Default questions about samtools mpileup & bcftools

some silly questions:

1. -F FLOAT minimum fraction of gapped reads for candidates [0.002]
what's the meaning of gapped reads? does that mean the reads are juntion reads?
for example:B810KBABXX:8:27:6656:80899#ACAGTGAT 99 chr1 509019 255 76M2010N24M = 511155 0 TCTCCTCCAAGACAACCCGCTGTCCGTCCAGACTCGATATAGGGGCTCCGAGGTCCAGGGGCTCCTTCTCTCCACTCAGCCTCACCAGCAGGCCACTGAG FFF+FGGGGGHHFHHHHHHHHFCHHHFH?HCGFDGEEEFEHDHHBFEFHB9AD<DFDEEBE:EEEEHEEECEEB@DGEEFH?HFFHBBHFEHCF9:/:76 NM:i:0 XS:A:- NH:i:1

2.are there any parameters to filter or control the mismatch near to or just in the end of a read?

3.what's the meaning of 'cap mapping quality'?
chenjy is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off



All times are GMT -8. The time now is 04:10 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO