SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Custom primers and PhiX on MiSeq gleb Illumina/Solexa 14 05-09-2017 09:53 AM
Failed NextSeq 500 v2 runs w/ custom sequencing primer kakseq Illumina/Solexa 4 10-05-2016 06:25 PM
MiSeq runs failed "focus out of spec" thermophile Illumina/Solexa 6 09-23-2015 07:25 AM
Using MiSeq with both standard and custom sequencing/index primers at the same time? kevin_bryant Illumina/Solexa 1 02-27-2014 01:57 PM
miseq custom primers barturas Illumina/Solexa 1 07-01-2013 06:46 AM

Reply
 
Thread Tools
Old 03-24-2017, 06:44 AM   #1
katinka03
Junior Member
 
Location: Ulm

Join Date: Aug 2016
Posts: 3
Default Spiking custom primers failed on Miseq runs

Hi all,

I would like to know if somebody encountered the same problem as we do at the moment.
Since Mid February we are no longer able to spike our Fluidigm custom primers (CS1 and CS2) into the Illumina primers (Miseq V2 nano kit 500 cycles).
We tried now 4 times with different libraries and also with a library that worked before but got no results but PhiX reads.
When we used the CS1 and CS2 primers as custom primers alone the library was read as usual.
We tested the primers with our libraries in a normal pcr and they gave perfectly strong signals.

Thanks
katinka03 is offline   Reply With Quote
Old 03-24-2017, 10:43 AM   #2
thermophile
Senior Member
 
Location: CT

Join Date: Apr 2015
Posts: 212
Default

Have you tried new aliquots of the primers? PCR would work but sequencing fail if the primers are mixed up (R1 in R2 well, R2 in R1 well)
__________________
Microbial ecologist, running a sequencing core. I have lots of strong opinions on how to survey communities, pretty sure some are even correct.
thermophile is offline   Reply With Quote
Old 03-26-2017, 11:52 PM   #3
katinka03
Junior Member
 
Location: Ulm

Join Date: Aug 2016
Posts: 3
Default

As usual, in the beginning we were assuming the error to be on our side and we had the same idea: mixed primer directions. But we have used the same primers without Illumina primers as custom read primers and they worked.
And we spiked the Fluidigm primers as pairs into Illumina primers and this did not work.
We just wonder if we are the only ones having troubles or if this is something new and others are struggling the same way?
katinka03 is offline   Reply With Quote
Old 03-27-2017, 07:01 AM   #4
thermophile
Senior Member
 
Location: CT

Join Date: Apr 2015
Posts: 212
Default

you could order the primers that hit phix and put those with your custom primers in the custom primer wells.

These are the primers that should hit phiX (I haven't tested them but this is what FAS told me to order)

Illumina.phix.R1
ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Illumina.phix.R2
CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
__________________
Microbial ecologist, running a sequencing core. I have lots of strong opinions on how to survey communities, pretty sure some are even correct.
thermophile is offline   Reply With Quote
Old 03-27-2017, 07:33 AM   #5
katinka03
Junior Member
 
Location: Ulm

Join Date: Aug 2016
Posts: 3
Default

This is a very good idea! Thanks, I will definitely try it.
katinka03 is offline   Reply With Quote
Reply

Tags
custom primers, failed runs, miseq, spiking

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:58 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO