SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Ion Torrent



Similar Threads
Thread Thread Starter Forum Replies Last Post
Difference between Ion torrent proton and Ion PGM Bionerd Ion Torrent 7 09-30-2015 01:55 PM
Sequencing Ion PGM libraries using Ion Proton MissDNA Ion Torrent 2 03-03-2014 11:07 AM
Library prep kits for Ion PGM or Ion Proton Bioo Scientific Vendor Forum 0 02-18-2013 06:25 AM
TruSeq Adaptors reported by FastQC are true adaptors? Jiafen Bioinformatics 3 11-07-2012 01:07 PM
Ion Torrent $1000 Genome!? Benchtop Ion Proton Sequencer aeonsim Ion Torrent 88 10-28-2012 04:50 AM

Reply
 
Thread Tools
Old 01-14-2016, 05:02 AM   #1
JoF
Junior Member
 
Location: Germany

Join Date: Aug 2014
Posts: 2
Default Ion S5 adaptors

Hi,
I'm new to Life Tech semi conductor Sequencing and only have MiSeq experience. We were offered a demo run of the Ion S5 and I would like to produce the library beforehand with our custom protocol.

Can anyone tell me if the Ion torrent adaptors are the same for the Ion S5?

Fwd: CCATCTCATCCCTGCGTGTCTCCGACTCAG

Rev: CCTCTCTATGGGCAGTCGGTGAT

cheers,
JoF
JoF is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:35 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO