SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Cuffmerge Error ercfrtz Bioinformatics 12 05-19-2014 09:02 PM
cuffmerge problems ccstaats Bioinformatics 0 02-02-2012 04:28 AM
cuffmerge problem camelbbs RNA Sequencing 0 11-06-2011 04:58 PM
Questions about cuffmerge Jolin Bioinformatics 0 10-04-2011 12:46 AM
The test for cuffmerge fgh1124 Bioinformatics 5 07-28-2011 01:45 AM

Reply
 
Thread Tools
Old 09-28-2011, 04:28 PM   #1
wall_y
Junior Member
 
Location: China

Join Date: May 2011
Posts: 7
Default cuffmerge failed

any idea about this failure? how to make fasta have the same length? and what does this mean? thank you!

[Wed Sep 28 20:19:22 2011] Beginning transcriptome assembly merge
-------------------------------------------

[Wed Sep 28 20:19:22 2011] Preparing output location ./merged_asm/
[Wed Sep 28 20:19:22 2011] Converting GTF files to SAM
gtf_to_sam: /usr/lib64/libz.so.1: no version information available (required by gtf_to_sam)
[20:19:22] Loading reference annotation.
gtf_to_sam: /usr/lib64/libz.so.1: no version information available (required by gtf_to_sam)
[20:19:22] Loading reference annotation.
gtf_to_sam: /usr/lib64/libz.so.1: no version information available (required by gtf_to_sam)
[20:19:23] Loading reference annotation.
[Wed Sep 28 20:19:23 2011] Quantitating transcripts
cufflinks: /usr/lib64/libz.so.1: no version information available (required by cufflinks)
You are using Cufflinks v1.1.0, which is the most recent release.
[bam_header_read] EOF marker is absent.
[bam_header_read] invalid BAM binary header (this is not a BAM file).
File ./merged_asm/tmp/mergeSam_fileu98BBT doesn't appear to be a valid BAM file, trying SAM...
[20:19:23] Loading reference annotation.
[20:19:24] Inspecting reads and determining fragment length distribution.
Processed 4610 loci.
> Map Properties:
> Total Map Mass: 27713.00
> Read Type: 0bp single-end
> Fragment Length Distribution: Truncated Gaussian (default)
> Default Mean: 200
> Default Std Dev: 80
[20:19:24] Assembling transcripts and estimating abundances.
Processed 4610 loci.
[Wed Sep 28 20:19:53 2011] Comparing against reference file xxx.gtf
You are using Cufflinks v1.1.0, which is the most recent release.
No fasta index found for ../bowtie-0.12.7/genomes/chr.fasta. Rebuilding, please wait..
Error: sequence lines in a FASTA record must have the same length!
[FAILED]
Error: could not execute cuffcompare

Traceback (most recent call last):
File "/home/student/yujinhai/cufflinks-1.1.0.Linux_x86_64/cuffmerge", line 573, in ?
sys.exit(main())
File "/home/student/yujinhai/cufflinks-1.1.0.Linux_x86_64/cuffmerge", line 556, in main
compare_meta_asm_against_ref(params.ref_gtf, params.fasta, output_dir+"/transcripts.gtf")
File "/home/student/yujinhai/cufflinks-1.1.0.Linux_x86_64/cuffmerge", line 406, in compare_meta_asm_against_ref
tmap = compare_to_reference(gtf_input_file, ref_gtf, fasta_file)
File "/home/student/yujinhai/cufflinks-1.1.0.Linux_x86_64/cuffmerge", line 342, in compare_to_reference
exit(1)
TypeError: 'str' object is not callable
wall_y is offline   Reply With Quote
Old 09-28-2011, 11:50 PM   #2
gringer
David Eccles (gringer)
 
Location: Wellington, New Zealand

Join Date: May 2011
Posts: 838
Default

The command line that you ran would be useful, as well as the first few lines of input files. The warnings about conversion and lack of GTF version information are a little odd.

Quote:
how to make fasta have the same length? and what does this mean?
Looking at the cufflinks code, it's expecting a fairly standard fasta format with equal-length lines (except for the last line) in each fasta record. Something like this:
Code:
>gi|347448407|gb|JN582205.1| Dorylomorpha spinosa voucher KNWR:Ento:4382 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
AACATTATATTTTATATTTGGTGCCTGAGCAGGAATAGTGGGTACATCCCTAAGAATCCTTATTCGAGCT
GAACTAGGACATCCAGGATCACTAATTGGAGATGACCAAATTTATAACGTAATTGTAACAGCTCATGCTT
TTGTGATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTCGGGAATTGACTAGTACCCCTAAT
ACTAGGAGCTCCTGACATAGCATTCCCTCGTATAAACAATATAAGATTTTGAATATTACCCCCATCATTA
TCCCTTCTACTCCTTAGAAGAATAACTAACAACGGAGCTGGTACCGGATGAACGGTATACCCACCACTAT
CATCAAACATCGCCCACGAAGGTGCATCAGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTC
ATCAATTCTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGTTCAACAGGAATTTCATTTGAC
CGAATACCTTTATTTGTATGGGCAGTAGTAATTACAGCATTATTACTTCTTTTATCATTACCAGTTCTTG
CAGGAGCCATTACTATACTATTAACAGACCGAAATTTTAATACTTCATTCTTTGACCCGGCTGGAGGAGG
TGACCCAATTTTATACCAACATTTATTT
rather than this:
Code:
>gi|347448407|gb|JN582205.1| Dorylomorpha spinosa voucher KNWR:Ento:4382 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
AACATTATATTTTATATTTGGTGCCTGAGCAGGAATAGTGGGTACATCCCTAAGAATCCTTATT
CGAGCTGAACTAGGACATCCAGGATCACTAATTGGAGATGACCAAATTTATAACGTAATTGTAACAGCTCATGCTT
TTGTGATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTCGG
GAATTGACTAGTACCCCTAATACTAGGAGCTCCTGACATAGCATTCCCTCGTATAAACAATATAAGATTTTGAATATTACCCCCATCATTA
TCCCTTCTACTCCTTAGAAGAATAACTAACAACGGAGCTGGTACCGGATGAACGGTATACCCACCAC
TATCATCAAACATCGCCCACGAAGGTGCATCAGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTC
ATCAATTCTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGTTCAACAGGAATTTCATTTGA
CCGAATACCTTTATTTGTATGGGCAGTAGTAATTACAGCATTATTACTTCTTTTATCATTACCAGTTCTTG
CAGGAGCCATTACTATACTATTAACAGACCGAAATTTTAATACTTC
ATTCTTTGACCCGGCTGGAGGAGGTGACCCAATTTTATACCAACATTTATTT
gringer is offline   Reply With Quote
Old 09-29-2011, 01:54 AM   #3
wall_y
Junior Member
 
Location: China

Join Date: May 2011
Posts: 7
Default thank you for reply

Thank you for your reply, i checked my fasta file, and it seems to be right as you mentioned.(though they seem not have same length, but actually they do.)

>chr
CCGCGGCGCTGCTCCCGGCGCTCCGCGCCGGGAGACGGGGCGAGTCGCTGCGCTCCCCGCCAGGGAGCCG
CTGCGCGGCTCGCAGTGGGTCGATTCCCGTTGCCGTCGATCGAGTCGCTTCGCTCCTCTGAGTTTCCGAG
ATTAGGTTCTCGCCTGCACTTTTCATCGTCCCGTTCGATCCGGTCCCCCGCACCCCAACGGGGCTGGAGA
AGCGGGAGGGTGTGCCCGACCCGCCGCCCACTCGCCTTCCCGCACCGCTCCATGTCATACCCACAGCATA
CCACCCGGCACCCTCGAATCCCAAAACAGACGAAAAACTTAAAACACCCATATCTGTTGATAATCAACCT
TTTTCGAACCTTACAATCTGAAAAACGTGCACAACCCACGTAAAAACTTACTCACCAAGTAATTACCCAA
ACATGTTGTCAATCAATACCTTTCAGAAACGGCTCGAAAACGGACGAAGCAGACACCCCCACGCCCGCCG
ACACCCCGGCGCCGGCACTCACCCGACAGGTCGCCGACACCCCACATCACAAACCGGAGACATGTCATCA
CACCAGGTCACAGCACCATTACGCCCGCGGGTGCCGAGGTCGCATCGATCCCACCCAGAATGGGCAGCAG
AGATTCAGCAGCGGATCGCGTCGCTCGCGGCGACGCCTTGGGGCGGGAGCGCGTCATCGTGTTCGAGAGA
TTCTCCGATCAAGCCCGCCACGTGGTCGTCCTCGCCGCCGGCGCCGCCCGCACCCACCACCAGAACTGGC


so i don't know how to fix it.

the warnings are really wired, i don't even have a clue what's going wrong.


[QUOTE=gringer;52590]The command line that you ran would be useful, as well as the first few lines of input files. The warnings about conversion and lack of GTF version information are a little odd.



Looking at the cufflinks code, it's expecting a fairly standard fasta format with equal-length lines (except for the last line) in each fasta record. Something like this:
Code:
>gi|347448407|gb|JN582205.1| Dorylomorpha spinosa voucher KNWR:Ento:4382 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
AACATTATATTTTATATTTGGTGCCTGAGCAGGAATAGTGGGTACATCCCTAAGAATCCTTATTCGAGCT
GAACTAGGACATCCAGGATCACTAATTGGAGATGACCAAATTTATAACGTAATTGTAACAGCTCATGCTT
TTGTGATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTCGGGAATTGACTAGTACCCCTAAT
ACTAGGAGCTCCTGACATAGCATTCCCTCGTATAAACAATATAAGATTTTGAATATTACCCCCATCATTA
TCCCTTCTACTCCTTAGAAGAATAACTAACAACGGAGCTGGTACCGGATGAACGGTATACCCACCACTAT
CATCAAACATCGCCCACGAAGGTGCATCAGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTC
ATCAATTCTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGTTCAACAGGAATTTCATTTGAC
CGAATACCTTTATTTGTATGGGCAGTAGTAATTACAGCATTATTACTTCTTTTATCATTACCAGTTCTTG
CAGGAGCCATTACTATACTATTAACAGACCGAAATTTTAATACTTCATTCTTTGACCCGGCTGGAGGAGG
TGACCCAATTTTATACCAACATTTATTT
Attached Images
File Type: png Screen Shot 2011-09-29 at 5.47.06 PM.png (21.2 KB, 10 views)
wall_y is offline   Reply With Quote
Old 06-26-2012, 07:43 AM   #4
Francesc
Junior Member
 
Location: CT

Join Date: Dec 2009
Posts: 2
Default

This is a really old thread, but just in case somebody has the same problem,
I solved it removing the extra new line at the end of my fasta file.

Since my fasta file only had one record I only removed one empty line.
I don't know if all empty lines would need to be removed for multiple fasta files.
Francesc is offline   Reply With Quote
Old 07-12-2012, 06:25 AM   #5
drdna
Member
 
Location: Kentucky

Join Date: May 2012
Posts: 75
Default

I was getting this error until I removed all empty lines between separate sequences.
drdna is offline   Reply With Quote
Reply

Tags
cuffmerge, fasta format, read type

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:42 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO