SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
cnv-seq - what do I set the --ref parameter to? david_d Bioinformatics 1 07-01-2015 08:38 AM
How to correct a ref seq using Illumina Antony03 General 1 10-06-2014 11:13 AM
Ref column for 2 factor RNA-Seq time course anandksrao Bioinformatics 0 03-25-2012 10:02 PM
where can I get ref seq hg18 culmen Bioinformatics 2 07-20-2010 12:28 PM
what can be done with micro rna seq from SOLiD of an organism with no ref? KevinLam Bioinformatics 0 06-02-2010 07:45 PM

Reply
 
Thread Tools
Old 09-23-2021, 08:39 AM   #1
radood
Junior Member
 
Location: USA

Join Date: Oct 2019
Posts: 5
Default MD tags with different ref seq

Hi, I came across this puzzling finding. I have two different reads in a bamfile, with the same exact sequence. For one of them, when I look at the MD aligned pairs, it seems like the last position (position 42) matches to the reference sequence (the T is written in capital letter case).

TTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCAT
(42, 25398283, 'T')

But for the other read, the MD aligned pairs show that the last position (position 42) is a mismatch and the reference sequence should be a C at that position (C is written in small letter case).

TTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCAT
(42, 25398283, 'c')

In reality, the reference sequence at that position (chr12:25398283 in hg19) is a C but I don't understand why there is a difference in the MD aligned pairs between these two different reads that have the same exact sequence. Any ideas?

Thanks so much!

Note: this numbering is 0-based indexing in pysam. So looking up the position in a 1-based indexing genome browser would be off by 1 (25398284 instead of 25398283)

Last edited by radood; 09-23-2021 at 08:42 AM.
radood is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:49 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO