SEQanswers

Go Back   SEQanswers > Applications Forums > Epigenetics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to know whether its Read1(Forward) or Read2(Reverse) from fastq contents. vaibhavvsk Illumina/Solexa 3 12-24-2015 03:23 AM
BWA aligned pairs read1=XT:A:U, read2=XT:A:R jflowers Bioinformatics 1 07-29-2014 10:06 PM
How do the Nextera Read1 and Read2 primers both work Phage434 Illumina/Solexa 6 12-22-2013 05:29 AM
Read1 and Read2 are not consistent priya Illumina/Solexa 2 07-16-2013 02:42 AM
Current read1, index, and read2 primers for HiSeq2000 SeqVicious Illumina/Solexa 1 09-26-2011 02:12 PM

Reply
 
Thread Tools
Old 08-02-2016, 09:14 AM   #1
emacalate
Junior Member
 
Location: Cleveland

Join Date: Dec 2014
Posts: 1
Question ATAC-seq (Read1/Read2/Index Sequencing Primers?)

Hi,

We recently prepared samples for ATAC-seq using primers from the Buenrostro et al paper.

Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
Ad2.1 CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT

Does anyone know the Read1/Read2/Index primers to use to read out sequences from ATAC-libraries on the Illumina sequencer (for paired end sequencing)? Are these custom primers?

I was told to use Nextera sequencing primers, but I can't figure out how these work for ATAC-libraries. Maybe I have the wrong sequences downloaded?

Any help would be greatly appreciated!

Thanks,

Steve
emacalate is offline   Reply With Quote
Old 08-30-2016, 11:11 AM   #2
SeleneT
Junior Member
 
Location: La Jolla, CA

Join Date: Aug 2016
Posts: 2
Default ATAC sequencing primers

Hello,
if you're sequencing on Illuminas NextSeq, their sequencing kits higher than v2 include Nextera primers.
I presume the most recent versions of HiSeq kits should be the same, though I've yet to sequence with them, so check with Illumina tech support or whomever you'll be sequencing with to be sure.
If not, or you're planning to use an older chemistry version kit, the Nextera kit should have come with indexing primers. Check with Illumina's web site for correct dilutions to add, or your sequencing service provider should be able to help. Happy sequencing!
Selene.
SeleneT is offline   Reply With Quote
Reply

Tags
atac, atac-seq, epigenetics, libraries, primers

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:49 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO