SEQanswers

Go Back   SEQanswers > Applications Forums > Epigenetics



Similar Threads
Thread Thread Starter Forum Replies Last Post
RNA-seq technical replicates at library construction level obig Bioinformatics 9 08-15-2012 11:43 PM
RNA-Seq: Correction: A Low-Cost Library Construction Protocol and Data Analysis Pipel Newsbot! Literature Watch 1 02-14-2012 11:02 AM
RNA-Seq: A Low-Cost Library Construction Protocol and Data Analysis Pipeline for Illu Newsbot! Literature Watch 0 11-01-2011 02:40 AM
ChIP-Seq with truseq kit? edawad Illumina/Solexa 2 05-11-2011 02:55 PM
PE mRNA seq library construction LLL109 Sample Prep / Library Generation 0 03-08-2010 12:17 PM

Reply
 
Thread Tools
Old 08-19-2011, 02:12 AM   #21
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 310
Default

Just to follow up and say the protocol worked great. I've posted the details on my new blog at:
http://ethanomics.wordpress.com/2011...imers-results/
__________________
--------------
Ethan
ETHANol is offline   Reply With Quote
Old 08-19-2011, 05:31 AM   #22
jlove
Member
 
Location: Boston, MA

Join Date: Apr 2011
Posts: 47
Default

Great protocol! Question about adapter concentration. Is 0.25 uM stock the concentration of the combined adapters or each one? Is it basically the Illumina tube of adapter at 25 uM diluted 1:100?

Thanks!
jlove is offline   Reply With Quote
Old 08-19-2011, 07:46 AM   #23
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,212
Default

I was thinking about this again. How about if the PPC oligos have ~60 nt 5' "heads" on them. For example 60 A's, then the actual priming site oligo. The result, after a couple of cycles, would be each product amplicon as a single stranded molecule would have a poly A tail on one end and a poly T tail on the other. (Those are just examples, could be other sequences.)

What for? This would allow a stem structure to form. The stem would be less available for primer annealing, once it formed. Because the formation of this stem would be unimolecular, it might be faster than the bimolecular primer annealing step. The stability of the stem loop structure would, in part, be determined by how large the loop (the insert) was. This is the basis of the the "PCR suppression effect" or sometimes called "pan-handle PCR". It can be used to compensate for PCR's short product bias.

--
Phillip

Quote:
Originally Posted by pmiguel View Post
Here is some evidence that the TruSeq PCR primers are just the entire TruSeq adapter oligos:
We ran an Agilent RNA pico chip on 0.2 ul from the "PPC" (PCR primer cocktail) from:

A DNA TruSeq A kit:


An RNA TruSeq Bkit:


Here is the ladder electropherogram for that chip:


The sizes are a little longer than expected (58 and 63 nt for the A strand and B strand oligos, respectively). But I guess that is down to mediocre accuracy for the pico chip in that size range.
--
Phillip
pmiguel is offline   Reply With Quote
Old 08-20-2011, 01:50 AM   #24
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 310
Default

Quote:
Originally Posted by jlove View Post
Great protocol! Question about adapter concentration. Is 0.25 uM stock the concentration of the combined adapters or each one? Is it basically the Illumina tube of adapter at 25 uM diluted 1:100?

Thanks!
0.25 μM means 0.25 μM for each adapter primer. You might consider diluting them a little more say to 0.125 μM. I'm not sure what the concentration of the adapters form Illumina are.

Phillip, I think you may be on to something. But since the goal is not to make long PCR fragments but short ones in the neighborhood of 300-500 bp, it doesn't sound exactly right. But the overhang sounds like a reasonable explanation. Maybe the p5 and p7 binding sites are repeated and that enhances attachment to the flow cell and cluster generation. Or maybe the extended length increases yield with the Agencort beads. I don't know but I am curious. There has to be someone that can mass spec them. Such a simple thing to do.
__________________
--------------
Ethan
ETHANol is offline   Reply With Quote
Old 08-20-2011, 03:33 AM   #25
xp8
Junior Member
 
Location: CT, USA

Join Date: Jun 2011
Posts: 2
Default

In a test I have to sequencing the DNA fragments as short as possible (above 40 bases).

There is a question:
What is the bottom line of size that we can sequence with TreSeq system?
Particularly, If I use 75bp X 2 sequencing, can I do sequencing as short as 40 bases (inset size)? or I have to sequence >75 bp insert?

Your opinion will be very well appreciated.

Victor
xp8 is offline   Reply With Quote
Old 08-22-2011, 04:10 AM   #26
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,212
Default

Quote:
Originally Posted by ETHANol View Post

[...]

Phillip, I think you may be on to something. But since the goal is not to make long PCR fragments but short ones in the neighborhood of 300-500 bp, it doesn't sound exactly right. But the overhang sounds like a reasonable explanation. Maybe the p5 and p7 binding sites are repeated and that enhances attachment to the flow cell and cluster generation. Or maybe the extended length increases yield with the Agencort beads. I don't know but I am curious. There has to be someone that can mass spec them. Such a simple thing to do.
I don't have a mass spec handy. (By which I mean I would have to submit it to another core on campus.) I heard that by doing a limited Snake Venom Diesterase digestion + mass spec you can determine oligo sequences.

Seems like cloning some PCR "enriched" TruSeq amplicons and Sanger sequencing would be one way to go. But that would be getting a little "meta" -- kind of an Easter Egg hunt, courtesy of Illumina, Inc. Maybe someone has already done this, to QC a library? If so, maybe they could slake our curiosity?

--
Phillip
pmiguel is offline   Reply With Quote
Old 08-22-2011, 06:11 AM   #27
jlove
Member
 
Location: Boston, MA

Join Date: Apr 2011
Posts: 47
Default

duplicate post, sorry

Last edited by jlove; 08-22-2011 at 06:14 AM. Reason: duplicate post
jlove is offline   Reply With Quote
Old 08-22-2011, 06:12 AM   #28
jlove
Member
 
Location: Boston, MA

Join Date: Apr 2011
Posts: 47
Default

[QUOTE=jlove;49657]
Quote:
Originally Posted by ETHANol View Post
0.25 μM means 0.25 μM for each adapter primer. You might consider diluting them a little more say to 0.125 μM. I'm not sure what the concentration of the adapters form Illumina are..

Regarding adapter - I made my own TruSeq adapters and I wanted to get them the same concentration as Illumina's...so I ran them out at a few concentrations on the smRNA chip (boiled first) alongside the Illumina ones. For what it's worth, my 8-15 uM (each) dilutions looked most similar to the Illumina ones. I had also made 25 uM, 20 uM and the peaks were much higher
jlove is offline   Reply With Quote
Old 10-13-2011, 06:16 AM   #29
advanT
Member
 
Location: South Africa

Join Date: Oct 2009
Posts: 22
Default

Hi ETHANol, pmiguel, I'm glad you're both on this thread because I have questions for both.

I tried your chip-seq protocol (thanks for making this available by the way) with 10 ng of fragmented genomic DNA (not chip) and was able to get libraries at 220 bp however I see a higher molecular weight band between 400 and 500 bp on my agarose gel. These are the only two bands that I see on the gel. After my gel size selection I only expected to see the 220 bp band. The higher MW band is twice as intense as my expected band. Any suggestions?
pmiguel, I've read some of your posts about these mysterious higher MW bands and am wondering if this is the same thing.

Are there any magic bullets to eliminate these? Has anyone tried sequencing their sample, leaving it in there? Unfortunately because they are so close you can't really separate one from the other unless you do a gel cut. I'm just worried about that because I considered myself fortunate to even see the low input on a gel.
advanT is offline   Reply With Quote
Old 10-13-2011, 07:28 AM   #30
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 310
Default

avanT, just to be sure I am understanding you correctly you see the 450 bp band after amplification. If so this is from over amplification of your library.

See these threads:
http://seqanswers.com/forums/showthread.php?t=9124
http://seqanswers.com/forums/showthread.php?t=11962
and probably more.

Bottom line is it doesn't matter and that big band is actually 220 bp DNA fragments annealed at the adapters but with non-homologous inserts which form after PCR primers becoming limiting. Your library is fine. Send it for sequencing as is. You could have gotten away with less PCR cycles, but it is not big deal. The DNA will be denatured for cluster generation so it's all ok.

If you really want to get rid of the 450 bp band do one cycle of PCR with your library (98˚ 1 min - 72˚ C 5 min with enzyme, dNTPS and PCR Primer Oligos!!) and the big band will magically disappear. But you do not need to do this and it is preferable not to because you just will get one more cycle of PCR bias.
__________________
--------------
Ethan

Last edited by ETHANol; 10-13-2011 at 08:34 AM.
ETHANol is offline   Reply With Quote
Old 10-13-2011, 08:17 AM   #31
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,212
Default

Quote:
Originally Posted by ETHANol View Post

If you really want to get rid of the 450 bp band do one cycle of PCR with your library (98˚ 1 min - 72˚ C 5 min with enzyme and dNTPS) and the big band will magically disappear. But you do not need to do this and it is preferable not to because you just will get one more cycle of PCR bias.
You have to add primer also, right?

By the way, you can just strand denature your sample (95 oC 2 minutes, "snap chill" on ice) just prior to loading it on an RNA bioanalyzer chip for QC. Since the multimers result from ectopic strand annealing, if you assay them single-stranded, you don't see that artifact. At least if they don't reanneal during the assay...

The down-side is that the RNA output result from the 2100 Expert software is much more limited than the DNA output results. Also, if your sample does re-anneal, the dsDNA will run shorter than the ssDNA, whereas the ssDNA amplicons annealed at one or both 60 nt adapter ends will run longer, probably. If you are submitting your sample to a core for QC, you might want to do the denaturation in formamide and submit it in formamide. Well, if you have a good source of pure formamide -- formamide can go bad and then it just messes up many downstream assays. Only for QC though! If submitting for sequencing I don't know what the effect of submitting in formamide instead of water would be.

Oh, I just thought of another down-side to RNA chips -- the size standard sucks! But this may just be because single stranded molecules do not produce the nice tight bands that double stranded molecules do?

--
Phillip
pmiguel is offline   Reply With Quote
Old 10-13-2011, 08:38 AM   #32
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 310
Default

Yes, you need to include oligos as well (I edited the post for clarity). But I think your idea of running 1 ul on an RNA gel is better. Or just don't worry about it at all. I have sequenced samples with the extra band and the data generated was good.
__________________
--------------
Ethan
ETHANol is offline   Reply With Quote
Old 10-13-2011, 10:21 AM   #33
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,212
Default

Yes, generally should not be a problem. Always irritating to try to guess my average amplicon size on one of those double-humpers though. And, being new to Illumina libraries, I'm paranoid there could be adapter-dimers annealed to the main library molecules.

Speaking of which, did you read any of the patent disclosure for Illumina library construction someone posted in another thread yesterday? I could not make it all the way through -- extremely wordy. But they did belabor the fact that their PCR primers included the 3' T overhang bases as a method of selecting against adapter-dimers during enrichment PCR. Well "belabor" may not be the right term. They made opaque references to a nearly indecipherable diagram in the disclosure over and over again. I guess the idea was not to actually disclose anything, but rather to have the appearance of having disclosed the technique while leaving it a mystery to anyone who could not figure it out for themselves.

But, that was the upshot: to get an adapter dimer you needed to remove the 3' T overhang to allow ligation to occur. But the PCR primers will not amplify such a product because they end with a "T".

But, I was thinking, oligonucleotide synthesis has an incredibly high error rate (compared to any polymerase, anyway.) So there must be at least 1 in 1000 oligos that have an "A" overhang, instead of a "T" overhang.

This was in addition to the phosphorothioate linkage to that overhanging T base -- to protect against exonuclease removal of the base. Sadly T4 polymerase happily cleaves these residues -- and that would be the nuclease most likely in play after the "end polishing" step.

But I digress... Remember the thread where you were trying to ascertain the sequence of the TruSeq enrichment PCR primers? I posted evidence that the length of their PCR primers was something crazy long (like at least the length of the entire 60 nt adapter, if not longer.) Well this would be justification for their using primers that long. To prevent the amplification of adapter dimers.

Part of the reason it seems insane though is that it would require their "PCR Primer Cocktail" (PPC) to actually contain all the index variations (12 or 24 of them) for primer 2.

I hope not! That would lead to rampant index switching!

--
Phillip
pmiguel is offline   Reply With Quote
Old 10-13-2011, 10:48 PM   #34
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 310
Default

That is interesting and seems to be a good idea. I doubt it would completely kill the amplification of the adapter dimers but it would most likely reduce the efficiency. Although G-T base pairs are reasonable stable I believe, so it might not be as efficient as it seems at the first look. So I'd say at this point, it sounds like it would be a good idea to use the Universal Adapter primer and a short primer corresponding the to the 5' end of the Indexed Adapter in the place of the PCR primer cocktail.

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T
and
CAAGCAGAAGACGGCATACGA*G

You would still get linear amplification of the adapter dimer from the short oligo but it should reduce the amount of adapter dimer amplification. Maybe I'll give it a try, but then again - If it's not broken, don't fix it. My protocol works well so why bother.

It seems like Illumina may have struggled some with the difficulties associated with removing the large TruSeq adapter dimers from their libraries.
__________________
--------------
Ethan
ETHANol is offline   Reply With Quote
Old 10-14-2011, 12:36 AM   #35
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 310
Default

advanT, one more thing. There was a BIG typo in the protocol I originally posted. It had the final step of PCR at 98˚C for 1 min. That was meant to be a final extension at 72˚C for one min!!!!! That could definitely cause some of your product to anneal as discussed above.
__________________
--------------
Ethan
ETHANol is offline   Reply With Quote
Old 10-14-2011, 04:37 AM   #36
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,212
Default

Quote:
Originally Posted by ETHANol View Post
You would still get linear amplification of the adapter dimer from the short oligo but it should reduce the amount of adapter dimer amplification. Maybe I'll give it a try, but then again - If it's not broken, don't fix it. My protocol works well so why bother.
I agree. Illumina appears to be pushing a "designed by geniuses for use by idiots" approach to protocol design. Probably goes over well with their IP lawyers because it also obfuscates their methodology.

That said, their kits actually do work well. At least if you can pierce the veil they erect around their protocols so you can see the potential failure modes...

--
Phillip
pmiguel is offline   Reply With Quote
Old 10-14-2011, 08:58 AM   #37
jlove
Member
 
Location: Boston, MA

Join Date: Apr 2011
Posts: 47
Default

I switched to using my own (short) P5 and P7 PCR primers and definitely get some dimer now, but I used to get adapter dimer when I was using the PCR components (master mix and primer) that came with the TruSeq kit as well. Did other folks have the same experience? For what it's worth, I started doing two rounds of bead purification after PCR and the dimer problem is greatly reduced, but not eliminated.
jlove is offline   Reply With Quote
Old 10-14-2011, 09:04 AM   #38
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,212
Default

We pretty much always do a gel-based size selection prior to the enrichment PCR. No adapter dimer if you do that. Actually we generally use fewer cycles of enrichment PCR as well.

BTW that ~85 bp peak is not adapter dimer. That is the PCR primers! Bizarre!

--
Phillip
pmiguel is offline   Reply With Quote
Old 11-16-2011, 05:18 PM   #39
captainentropy
Member
 
Location: San Francisco

Join Date: Mar 2009
Posts: 87
Default

FWIW, for library PCR (TruSeq kit) I've recently been using PE 1.0 from the old GAII kits (the sequence of which is readily available) and a homemade one I call TruSeq-R. The sequence is: 5' CAAGCAGAAGACGGCATACGAGAT 3'. It works great for library quantitation too.
captainentropy is offline   Reply With Quote
Old 11-16-2011, 09:06 PM   #40
Jon_Keats
Senior Member
 
Location: Phoenix, AZ

Join Date: Mar 2010
Posts: 279
Default

Hi Ethan,

I've been meaning to thank you for the CHIP-seq protocol. It seems to work great and everyone loves the idea of doing the pre-QPCR to figure out the optimum number of amplification cycles. I have a feeling this will become standard practice in all our library preps, particularly those that call for a significant number of amplification cycles. I'll try to have the lab post the modifications we made but briefly we followed your methods less:

CHIP is done using the Invitrogen Magnify kit after covaris sonication
We used the NEB mastermix CHIP kit

So far the libraries look great and the Kapa amplification is clearly light years better than the Phusion amplification, so thanks for the suggestion.

We are going to test Ampure versus the Qiagen columns in the near future and I'll try to update the outcome of those tests.

Thanks for sharing
Jon_Keats is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:19 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO